Среда, 8 февраля

Фруктоза и инсулин: Фруктоза — враг человека?

Фруктоза при сахарном диабете 1 и 2 типов: польза и вред

Диабетикам необходимо соблюдать особую диету. Особенно важно ограничивать употребление сахара, который рекомендуют заменить фруктозой. Она такая же сладкая, но не приводит к скачку уровня глюкозы, не требует для усвоения дополнительного инсулина. Хотя у нее есть и отрицательные для больных свойства. Врачи не могут прийти к единому мнению, можно ли фруктозу при сахарном диабете 2 типа, пользу или вред она приносит, как правильно ее употреблять.

Что это такое

Фруктоза – это моносахарид натурального происхождения, относится к простым углеводам. Содержится во фруктах, поэтому называется еще фруктовым сахаром. Это натуральный сахарозаменитель, который есть во многих продуктах. Мед содержит 80% фруктозы, а обычный белый сахар – 50%. Энергетические характеристики такие же, как у глюкозы: 99 г углеводов, 396 ккал на 100 г. Гликемический индекс в отличие от сахара составляет 20, а не 70. 12 г фруктозы – это 1 хлебная единица.

Раньше все врачи рекомендовали диабетикам фруктозу вместо сахара. Но сейчас к ней относятся не так позитивно. Современные исследования доказали, что этот моносахарид может быть вредным. Ученые в США определили, что увлечение сахарозаменителем привело к росту случаев ожирения и диабета 2 типа у здоровых людей.

Особенности метаболизма

Сахарный диабет развивается при невозможности организма усваивать глюкозу. При первом типе болезни поджелудочная железа не способна вырабатывать инсулин, нужный для ее расщепления. Диабет 2 типа развивается у людей лишним весом и нарушением обменных процессов. У них снижается резистентность к инсулину, и глюкоза не усваивается клетками.

При этой болезни необходимо снизить употребление углеводов. Но полностью их исключать нельзя, так как это незаменимый источник энергии. Поэтому вместо него рекомендуется употреблять сахарозаменители. Популярность фруктозы при диабете 2 типа объясняется особенностями ее расщепления, для которого требуется меньше инсулина. Усваивается она медленно, не расщепляется сразу, а попадает в печень, где накапливается.

Сначала считалось, что для проникновения фруктозы в клетку ей не нужен инсулин, поэтому ее добавляют во все диабетические продукты и рекомендуют больным вместо сахара. Но современные исследования ученых помогли понять, что она не проникает в клетки в чистом виде, в крови отсутствуют необходимые для этого ферменты. Фруктоза расщепляется в печени с выделением глюкозы. Только после этого она поступает в кровь. Если клеткам глюкоза не требуется, она перерабатывается в триглицериды и холестерин и накапливается в печени.

Где содержится

Несмотря на то, что среди врачей ведутся споры о пользе употребления фруктозы, 80% диабетических продуктов содержат этот сахарозаменитель. Его добавляют в жевательную резинку, зубные пасты, лекарственные препараты. Много ее в пакетированных соках, кетчупах, выпечке, десертах. Используется вещество, которое получается естественным путем из топинамбура или при расщеплении сахара. Продается этот сахарозаменитель отдельно в виде белого порошка.

Также он содержится во многих фруктах. Больше всего фруктозы в сухофруктах, сладких сортах груш и яблок, винограде, хурме – от 5 до 32%. Много в арбузах, черешне, клубнике, мандаринах, персиках.

По таблице видно, в каких продуктах ее содержится больше всего:











                                   Продукт

               Концентрация г/100 г

финики

31,9

изюм

28

черника

9

виноград

8,1

груша

6,2

яблоко

5,9

бананы

5,5

киви

4,3

персики

4

Полезные свойства

Популярность фруктозы для диабетиков объясняется тем, что она почти не повышает количество сахара в крови. Она легко усваивается даже у больных с нарушением углеводного обмена. Поэтому они могут употреблять сладости без риска получить гипергликемию. Для многих больных фруктоза решает проблему пресной пищи. В ее употреблении есть еще несколько положительных моментов:

  • слаще сахара, поэтому можно добавлять меньше по количеству и снизить калорийность пищи;
  • расщепление происходит без инсулина;
  • у мужчин способствует выработке сперматозоидов, предотвращает бесплодие;
  • не стимулирует развитие бактерий в полости рта, защищая зубы от кариеса и воспалительных заболеваний.

Вред фруктозы при сахарном диабете

Этот сахарозаменитель в 2 раза слаще сахара, больным сложно дозировать его правильно. Диабетики добавляют его столько же, сколько сахара. Поэтому часто допускают передозировку. Многие ученые не рекомендуют использовать его вместо сахара не только диабетикам, но и здоровым людям. Оно может принести вред организму:

  • медленно всасывается, человек не ощущает насыщения, поэтому возрастает риск переедания;
  • повышает аппетит, стимулирует выработку гормона голода грелина;
  • избыток вызывает заболевания прямой кишки, дисбактериоз, повышенное газообразование;
  • приводит к повышению уровня холестерина и риску развития атеросклероза и сердечных патологий;
  • может понижать чувствительность тканей к инсулину;
  • создает повышенную нагрузку на печень, так как расщепляется этой железой с образованием триглицеридов и гликогена, может вызвать ожирение печени;
  • часто приводит к накоплению лишнего веса, легко преобразуется в жир;
  • может повышать количество уратов, становится причиной развития подагры, мочекаменной болезни.

Особенности употребления

Ученые не могут однозначно ответить, можно ли употреблять фруктозу при диабете. Рекомендуется подходить к выбору сахарозаменителя индивидуально. Врач высчитает, какое количество будет для больного безопасным в зависимости от возраста и степени развития болезни. Обычно рекомендуется употреблять его детям до 0,5 г на килограмм массы тела, а взрослым пациентам – не более 0,75 г/кг. Но в сутки общее количество не должно превышать 50 г. Лучше всего получать фруктозу в натуральном виде.

Разные рекомендации дают врачи в зависимости от типа болезни. Добавлять фруктозу при сахарном диабете 1 типа разрешается с учетом объема инсулина и количества употребляемых Х. Е. Лучше считать ее отдельно, чтобы не получалось более 4 Х. Е. в сутки. Можно использовать конфеты на фруктозе или мед для купирования приступа гипогликемии. Но в нормальном состоянии от них лучше отказаться.

Фруктозу при сахарном диабете 2 типа нужно ограничивать количеством 30-40 г. Сюда входят не только продукты с ней, но и сладкие фрукты. Лучше отдавать предпочтение кислым сортам яблок, цитрусовым. Количество фруктов и ягод должно быть ограничено 300-400 г в день. А больным с сопутствующим ожирением или метаболическим синдромом рекомендуется совсем исключить из рациона продукты, содержащие этот сахарозаменитель.

Фруктозу разрешено употреблять диабетикам, но в ограниченных количествах и с учетом вида болезни. При передозировке она может спровоцировать появление серьезных сопутствующих заболеваний. Получать это вещество лучше в натуральном виде из фруктов. А диабетические продукты на фруктозе можно есть понемногу, чтобы ее поступало не более 30-40 г в день.

 

Фруктоза и ожирение печени — почему сахар является ядом

Автор: доктор Джейсон Фанг

Фруктоза еще теснее связана с ожирением и диабетом, чем глюкоза. С точки зрения диетологии ни фруктоза, ни глюкоза не содержат жизненно необходимых питательных веществ. И в качестве подсластителей они похожи. Тем не менее, фруктоза приносит больший вред здоровью человека по сравнению с глюкозой из-за своего уникального метаболизма в организме.

Обмен веществ глюкозы и фруктозы отличается во многих отношениях. Почти каждая клетка в нашем организме может использовать глюкозу для получения энергии, но никакие клетки не умеют использовать фруктозу. Когда фруктоза попадает в наш организм, она может метаболизироваться только печенью.  В то время как молекулы глюкозы могут рассеиваться по всему организму для использования в качестве энергии, молекулы фруктозы превращаются в управляемые ракеты, летящие в печень.

Когда мы едим много глюкозы, она начинает циркулировать практически в каждой клетке организма, которые помогают распределить эту нагрузку. Ткани тела, кроме печени, обрабатывают 80% съеденной глюкозы. Каждая клетка в организме, в том числе клетки сердца, легких, мышц, мозга и почек готовы полакомиться с глюкозного “шведского стола”. Это оставляет печени для переработки всего лишь 20%  глюкозной нагрузки. Большая часть этой глюкозы превращается в гликоген для хранения, оставляя немного глюкозы в качестве субстрата для производства нового жира.

Чего нельзя сказать о фруктозе. Большие количества съеденного нутриента идут прямо в печень, потому что никакие другие клетки не могут помочь использовать или переработать ее, тем самым значительно увеличивая нагрузку на печень. Уровни углеводов и инсулина в ней могут быть в 10 раз выше, чем в других частях системы кровообращения организма. Таким образом, печень подвергается гораздо более высоким уровням углеводов – и фруктозы, и глюкозы – чем любой другой орган в нашем теле.

Сравните удар молотком и укол иглой: всё давление направлено на одну точку. Сахароза обеспечивает равные количества глюкозы и фруктозы. В то время, как целых 75 кг тканей обычного человека обрабатывают глюкозу, равное количество фруктозы должно быть отважно обработано только 2,2 кг печени. Что это означает на практике: фруктоза, возможно, имеет в 20 раз больше шансов вызвать ожирение печени (ключевая проблема ведущая к инсулинорезистентности) по сравнению с одной глюкозой. Это объясняет, каким образом многие примитивные сообщества могли переносить чрезвычайно высокоуглеводные диеты без развития гиперинсулинемии или резистентности к инсулину.

Печень преобразует фруктозу в глюкозу, лактозу и гликоген. Нет никаких ограничений в этой системе обмена веществ для фруктозы. Чем больше вы едите, тем больше вы обрабатываете. Когда ограниченные запасы гликогена заполнены, избыток фруктозы переходит непосредственно в жир печени через де-ново липогенез (DNL). Перекармливание фруктозой может увеличить DNL в 5 раз, а замена глюкозы на равный по калорийности объём фруктозы увеличивает объем жира в печени на 38% в течение всего 8 дней. Именно это ожирение печени имеет решающее значение для развития резистентности к инсулину.

Способности фруктозы вызывать ожирение печени уникальны среди углеводов. Ожирение печени непосредственно вызывает резистентность к инсулину, приводя в движение порочный круг: гиперинсулинемия – резистентность к инсулину. Кроме того, этот вредный эффект фруктозы не требует высоких уровней глюкозы или инсулина в крови, чтобы посеять хаос. Действуя через жировую болезнь печени и резистентность к инсулину, этот ведущий к ожирению эффект не заметен в краткосрочной перспективе – только на протяжении длительного времени.

Метаболизм этанола (спирта) весьма похож на метаболизм фруктозы. После проглатывания, ткани тела могут усвоить только 20% спирта, оставляя 80% для вывода непосредственно в печень, где он метаболизируется в ацетальдегид, стимулирующий де-ново липогенез. Суть заключается в том, что алкоголь просто превращается в печеночный жир.

Чрезмерное потребление этанола является хорошо известной причиной жировой дистрофии печени. Так как ожирение печени – это важный шаг на пути к резистентности к инсулину, неудивительно, что чрезмерное употребление этанола также является фактором риска развития метаболического синдрома.

 

Фруктоза и резистентность к инсулину

Тот факт, что переедание фруктозы может вызвать резистентность к инсулину, был известен еще в 1980 году. Здоровым участникам исследования давали избыточную фруктозу соответствующую 1000 калорий в день, и результаты показали ухудшение их чувствительности к инсулину на 25% – и это после 7 дней эксперимента! Тем, кому давали дополнительные 1000 калорий глюкозы в день, не показали подобного ухудшения.

Более позднее исследование 2009 года подтвердило, насколько легко фруктоза вызывает резистентность к инсулину у здоровых добровольцев. Испытуемым давали 25% от их ежедневных калорий в виде Kool-Aid (бренд ароматизированного напитка от компании Kraft Foods), подслащенного либо глюкозой, либо фруктозой. Хотя эти дозировки могут показаться высокими, многие сейчас потребляют примерно такой же объем сахара в своем рационе. В группе с фруктозой, в отличие от группы с глюкозой, увеличилась резистентность к инсулину так стремительно, что участники вполне могли быть продиагностированы как пред-диабетики. Ещё примечательнее другой факт: для развития подобного состояния понадобилось только 8 недель переедания фруктозы.

Всего 6 дней избытка фруктозы в вашем рационе вызывает резистентность к инсулину. 8 недель потребуется, чтобы получить пред-диабетическое состояние. Что же произойдет после десятилетий высокого потребления фруктозы? Результатом станет эпидемия сахарного диабета – то, что происходит сейчас с нами. Переедание фруктозы стимулирует ожирение печени и приводит непосредственно к резистентности к инсулину.

В переедании фруктозы действительно есть что-то зловещее. Да, доктор Роберт Ластиг прав. Сахар  – это яд.

 

Факторы токсичности

Существует ряд причин, определяющих токсичность фруктозы. Во-первых, ее обмен веществ происходит исключительно в печени, поэтому практически весь ее объем после попадания в наш организм хранится в виде вновь созданного жира. В отличие от глюкозы, которую абсолютно все клетки могут метаболизировать.

Во-вторых, фруктоза преобразуется без ограничений. Чем больше мы потребляем фруктозы, тем интенсивнее происходит процесс печёночного де-ново липогенеза, и тем сильнее ожирение печени. Нет естественных тормозов в нашей системе, чтобы замедлить производство нового жира. Фруктоза непосредственно стимулирует DNL независимо от инсулина, поскольку диетическая фруктоза оказывает минимальное влияние на уровень глюкозы или инсулина в крови.

Метаболизм фруктозы регулируется менее жестко. Таким образом, он может перегрузить “экспортный механизм” печени, приведя к чрезмерному накоплению жира в ней. Мы поговорим о том, как печень пытается избавиться от вновь созданного жира в следующей главе.

В-третьих, в организме не предусмотрено другой альтернативы для обработки фруктозы. Избыток глюкозы хранится безопасно и легко в печени в качестве гликогена. При необходимости гликоген трансформируется обратно в глюкозу для легкого доступа к энергии. Фруктоза не имеет еще одного механизма для удобного хранения. Она метаболизируется в жир, который не может легко быть преобразован обратно.

Поскольку фруктоза является натуральным сахаром, а также считается частью рациона человека с древнейших времен, мы должны всегда помнить первый принцип токсикологии. «Всё — яд, всё — лекарство; то и другое определяет доза». Тело имеет возможность обрабатывать небольшое количество фруктозы. Это не означает, что оно способно обрабатывать неограниченное ее количество без негативных последствий для здоровья.

 

Выводы

Фруктоза когда-то считались безвредной из-за своего низкого гликемического индекса. В краткосрочной перспективе, очевидных рисков для здоровья мало. Фруктоза проявляет свою токсичность в основном за счет долгосрочных эффектов, ведя к ожирению печени и резистентности к инсулину. Этот эффект часто измеряется десятилетиями, что приводит к немалому количеству дискуссий.

Таким образом, сахароза или высокофруктозный кукурузный сироп, примерно с равными частями глюкозы и фруктозы, играют двойную роль в процессе ожирения и развитии диабета 2 типа. Это не просто «пустые калории». Это нечто гораздо более зловещее, и люди постепенно начинают это понимать.

Глюкоза – рафинированный углевод, который напрямую стимулирует инсулин. Тем не менее, большая его часть может сжечься для получения энергии, оставив лишь небольшие количества продуктов обмена в печени. Тем не менее, очень высокие уровни потребления глюкозы также приводят к ожирению печени. Эффекты от потребления глюкозы очевидно проявляются в изменении ее уровня в крови и ответной реакции инсулина.

Переедание фруктозы производит жировое перерождение печени, что, в свою очередь, непосредственно создает резистентность к инсулину. Фруктоза на пять-десять раз чаще способна спровоцировать ожирение печени по сравнению с глюкозой, создавая зловещий порочный круг. Устойчивость к инсулину приводит к гиперинсулинемии, так как организм пытается «преодолеть» это сопротивление. Тем не менее, все это имеет неприятные последствия, потому что  гиперинсулинемия усугубляется сопутствующей глюкозной нагрузкой, которая ведет к углублению состояния резистентности к инсулину.

Поэтому сахароза стимулирует выработку инсулина, как в краткосрочной, так и в долгосрочной перспективе. Таким образом, сахароза в разы более вредоносна, чем содержащие глюкозу крахмалы, такие, как амилопектин. Глядя на гликемический индекс, эффект от глюкозы очевиден, а эффект от фруктозы полностью скрыт. Этот факт уже давно ввел в заблуждение ученых, преуменьшавших роль сахара в эпидемии ожирения.

Воздействие инсулинорезистентности на ожирение накапливается в течение многих лет или даже десятилетий, прежде чем становится очевидным. Краткосрочные исследования полностью упускали этот эффект. Недавний системный анализ, рассмотревший множество исследований продолжительностью менее недели, пришёл к выводу, что фруктоза не вызывает особого эффекта, помимо содержащихся в ней калорий. Но последствия потребления фруктозы, например, ожирение, развиваются в течение десятилетий, а не недель. Если бы мы полагались на анализ только краткосрочных исследований о вреде курения, мы могли бы сделать ту же ошибку: посчитать, что курение не вызывает рак легких.

Сокращение в своем рационе сахара и сладостей всегда считается  первым шагом к снижению веса практически во всех диетах на протяжении всей истории человечества. Сахароза – это не просто пустые калории или рафинированный углевод. Она гораздо опаснее, так как одновременно стимулирует и выработку инсулина и резистентность к нему. Наши предки всегда знали этот факт, даже если они не знали физиологии.

Мы попытались отрицать это на протяжение нашей 50-летней одержимости калориями. Пытаясь обвинить во всем избыточную калорийность, мы не распознали естественную опасность от переедания фруктозы. Но невозможно бесконечно отвергать истину, а за невежество приходится дорого платить. Мы поплатились двойной эпидемией: сахарного диабета 2 типа и ожирения. Но уникальные свойства сахара, ведущие к ожирению, были, наконец-то, снова признаны. Это была истина, котороая подавлялась на протяжение долгого времени.

Так что, когда доктор Ластиг представил свою лекцию в 2009 году и заявил, что сахар является ядом, весь мир слушал его с напряженным вниманием. Поскольку этот профессор эндокринологии говорил нам то, что мы уже инстинктивно знали и считали верным. Несмотря на все банальные возражения и заверения, что сахар не является проблемой, мир уже знал, в глубине души, настоящую правду. Сахар  – это яд.

Оригинальная публикация на сайте dietdoctor.com

PS от LCHF.RU:

В российских магазинах продукты на фруктозе по-прежнему считаются диетическими и продаются в отделах здорового питания с соответствующей рекламой.

Здоровые низкоуглеводные продукты в нашем LCHF-магазине

Читайте также:

Сахар: горькая правда — главные тезисы легендарной лекции Роберта Ластига

Учёные объясняют почему сахар — это не еда

Почему нас тянет на сладкое, или сколько меда ели наши предки?

Новое исследование: мёд оказался не лучше сахара

Сироп агавы — натуральная, но нездоровая альтернатива сахару

Высокое потребление фруктозы во время беременности может повышать риск болезней среднего возраста у детей

Фруктоза усиливает тягу к вредной еде

Низкоуглеводная диета лечит ожирение печени, вызываемое… углеводами

Как фруктоза влияет на организм

Фруктоза превращается в жир. Она перерабатывается в печени, а если ее становится слишком много, она становится жиром и выбрасывается в кровь в виде триглицеридов, которые являются самым главным источником энергии для клеток. Однако их повышенное количество может вызвать риск сердечно-сосудистых заболеваний, развития атеросклероза и инфаркта миокарда. Помимо этого существуют и другие причины ограничить употребление фруктозы.

Фруктоза разжигает аппетит. Изначально считалось, что она отличный сахарозаменитель для тех, кто сидит на диете. Ведь у нее более низкий гликемический индекс, чем у сахара. Однако в реальности фруктоза — не лучший помощник при похудении. Дело в том, что она препятствует возникновению чувства насыщения. Поэтому, съев одно печенье на фруктозе, мы сразу тянемся за вторым, и нам хочется есть еще больше.

Фруктоза наносит вред печени. Большое количество негативно действует на печень и может привести к ее жировой болезни, а также нарушению восприимчивости к инсулину. На самом деле фруктоза влияет на печень практически так же, как алкоголь, который, как известно, является печеночным токсином. Ее избыток может спровоцировать сердечно-сосудистые заболевания и метаболический синдром. По сути, это комплекс обменных и гормональных нарушений, происходящий на фоне ожирения. Причем не внешнего, а внутреннего, когда жир откладывается на внутренних органах. Первый внешний признак — отложения в районе живота, проверить это очень легко, измерив талию. Для женщин тревожный признак — объем более 80 см, для мужчин — 94 см.

Фруктоза вызывает заболевания. В результате ее переработки вырабатываются так называемые конечные продукты гликации, способствующие целому ряду хронических заболеваний: атеросклерозу, диабету, болезни Альцгеймера и другим. Кроме того, они наносят окислительное повреждение и способствуют росту воспалительных клеток.

Сколько фруктозы можно употреблять в день

Мифы о фруктозе

Похудеть на продуктах, содержащих фруктовый заменитель сахара, не получится

В последние годы в аптеках появились витрины, заполненные продуктами, на упаковке которых написано крупными буквами: «Содержат фруктозу». Наверняка многие из нас с интересом приглядывались к этим полкам, а кто-то даже покупал джемы, вафли, печенье, конфеты, содержащие вместо банального сахара, казалось бы, без-вредный и, по нашему разумению, полезный компонент. Продукты с фруктозой предназначены для больных диабетом, но покупают их и люди, болезнью не страдающие, полагая, что с помощью лакомств из аптеки смогут справиться с тягой к сладкому и не испортить фигуру. Это мнение в корне ошибочно, считает врач-гастроэнтеролог Маргарита Сомова. Более того, есть опасность поправиться.

Торопится превратиться в жир

Из всех сахаров, встречающихся в природе, фруктоза самая сладкая. Она
практически в два раза слаще привычного нам сахара, имеющего второе название —
сахароза. Что характерно, при ощутимой разнице во вкусовых качествах
калорийность фруктоза и сахароза имеют одинаковую. Именно по этой причине в
некоторых журналах можно встретить советы: дескать, замените обычный сахар
фруктовым и получите в награду стройность, ведь в этом случае организм будет
получать в два раза меньше сладкого. Это большое заблуждение. Разберемся, что
происходит в нашем организме, когда туда попадают сахароза и фруктоза.

— Когда мы едим обычную шоколадку или пьем сладкий чай, мгновенно поднимается
уровень глюкозы в крови, — говорит Маргарита Сомова, врач-гастроэнтеролог. —
Здоровый человек этого не замечает, а вот для больного сахарным диабетом это
очень опасно. Чтобы глюкоза не причинила вреда, ей нужен инсулин, а поскольку у
людей, страдающих сахарным диабетом, с ним проблемы, то глюкоза атакует стенки
сосудов, вследствие чего туда проникает холестерин, образуются бляшки,
перекрывающие кровоток. Есть опасность инфаркта миокарда, инсульта. Фруктозе для
попадания в клетку помощь не нужна, из-за чего уровень сахара в крови не
меняется. Именно поэтому диабетикам рекомендуют сладкие блюда, содержащие
фруктовый сахар.

Людям, страдающим диабетом, не следует увлекаться лакомствами, содержащими
фруктозу. Дело в том, что, попадая в печень, часть этого вещества превращается в
глюкозу. И все же надо признать, что из всех сахаров именно фруктоза меньше
всего влияет на уровень сахара в крови. С продуктами, содержащими фруктозу,
стоит быть осторожными еще и по той причине, что клеткам нашего организма
фруктовый сахар фактически не нужен. Кроме того, он значительно быстрее, чем
глюкоза, превращается в жир. Съели вы, скажем, обычную конфетку — в крови
поднялся уровень глюкозы. Вы походили, подвигались — глюкоза сгорела. После того
как вы съели печенье с фруктовым сахаром — он поспешит превратиться в жир, а
сжечь жировые отложения будет куда сложнее, чем глюкозу.

— Организм не распознает фруктозу как углевод, — рассказывает Маргарита
Сомова. — У нас есть особые ферменты, которые все поступающие в организм
углеводы превращают либо в жир, либо в гликоген (это вещество, которое находится
в мышцах и печени и является легкоиспользуемым резервом энергии). В гликоген
превращаются полезные комплексные углеводы, например крупы, отруби. Когда
человек мало двигается и гликоген не расходуется, углеводы превращаются в жир.
Фруктоза лишена шансов стать гликогеном, печень всегда перерабатывает ее в жир,
который, попадая в кровь, превращается в жировые отложения.

Вызывает зверский аппетит

Неспроста, съев первое или второе блюдо, а и иногда и то и другое, мы ощущаем
словно бы некую недосказанность — вроде бы сыт, а чего-то хочется. Этим чем-то,
конечно же, является чашка чая с конфеткой или печенюшкой. Тяга к сладкому после
вроде бы обильной трапезы легко объяснима: просто чувство сытости зависит от
уровня глюкозы. И вот здесь вплывает еще одни минус фруктозы. Почитатели
фруктового сахара и люди, его рекомендующие, утверждают, что из-за чрезмерной
сладости фруктозы кладут в продукты меньше и, соответственно, в организм
человека попадает меньше калорий. Может быть, это и так, но тут есть подводный
камень: фруктоза не влияет на ощущение сытости. Так что человек может съесть
куда больше пряников с фруктовым сахаром, нежели с привычной сахарозой.

Американские ученые несколько лет изучали влияние глюкозы и фруктозы на
аппетит. Результаты исследований показали, что дей-ствие этих веществ на мозг
человека различно. Глюкоза не давала людям слишком объедаться, фруктоза же
наоборот — увеличивала аппетит. Американцы забили тревогу. Проблема в том, что
фруктоза содержится не только в диабетической пище, с каждым годом ее все более
активно используют в обычных продуктах питания.

— Фруктоза содержится практически во всех сладких газированных напитках,
которые так популярны у молодежи, — говорит врач Маргарита Сомова. — Сейчас
ученые пытаются проследить зависимость между употреблением продуктов, содержащих
фруктозу, и проблемой ожирения среди молодежи. Фруктоза содержится не только в
газированных напитках, но и в соках, которые позиционируют как натуральные. В
них не только естественные сахара из фруктов, но и обогащенный фруктозой
кукурузный сироп, который используют в восстановленных нектарах. Так что лучше
сок готовить самим, а еще лучше есть фрукты.

Фруктоза обладает довольно весомыми недостатками, но все они актуальны для
промышленного синтезированного фруктового сахара. Что же касается продуктов, в
которые этот сладкий компонент вложила сама природа, тут можно не опасаться. В
ягодах, фруктах и некоторых овощах (брокколи, лук, всех видах салата, моркови,
капусте, сладком перце) фруктоза содержится, но в небольшом количестве. Кроме
того, в этих продуктах присутствует глюкоза, а также такой важный компонент, как
клетчатка, которая препятствует быстрому всасыванию сахаров в кровь. Помимо
помощи людям, страдающим диабетическими заболеваниями, у фруктозы есть еще один
плюс: она на 20—30% способствует снижению риска развития кариеса и
воспалительных процессов в полости рта. Но оценить этот плюс лучше всего с
помощью фруктов и сырых овощей.

Интересный эксперимент

Исследователи предложили экспериментальным мышам на выбор воду, раствор
фруктозы и прохладительные напитки с фруктозой. У мышей, любителей
фруктозосодержащих напитков, отмечалась более существенная прибавка в весе, даже
при снижении общей калорийности рациона. У зверьков наблюдалась не только
прибавка веса, но и, что наиболее опасно, эта прибавка происходила на 90% за
счет жировой ткани. Было доказано, что некоторые гормоны, которые реагируют на
глюкозу (лептин, инсулин и др.), не выполняют своих нормальных функций при
употреблении фруктозы. Появление ожирения объясняется не только высокой
калорийностью фруктозы, но и замедлением метаболизма, что способствует
накоплению жира.

Как обуздать аппетит?

Пять способов обмануть собственный желудок

Пейте перед едой

Жидкость заполняет желудок, создавая иллюзию сытости. Лучший выбор — обычная
негазированная питьевая вода. Но можно попробовать щелочную минеральную воду.
Она нейтрализует кислый желудочный сок, который является причиной «сосания под
ложечкой».

Полюбите молоко

Ночной жор — проблема для многих. Справиться с ним поможет стакан теплого
обезжиренного молока.

Используйте травы

Настои многих из них уменьшают выработку желудочного сока. Пейте до еды
настои корня одуванчика, кукурузных рылец, липового цвета, дягиля, бузульника,
корня алтея, фукуса и спирулины. Можно настаивать на водяной бане, а можно
купить травы в пакетиках и заваривать как чай.

Нюхайте

Некоторые эфирные масла уменьшают голод. Это ваниль, грейпфрут, лимон, анис,
корица, укроп, острый перец, мята, яблоко, банан, лаванда и роза. Вдыхать их
надо перед приемом пищи и во время него.

Грейтесь

Если вам холодно, мозг думает, что организму не хватает энергии на обогрев, и
дает указание немедленно пополнить запас калорий. Одевайтесь теплее, не
допускайте сквозняков в доме, на улице носите теплую шапку, ведь сигнал о холоде
идет от головы. (aif.ru)

Полезна ли фруктоза? «Беда, коль сапоги начнет тачать пирожник…» / Хабр

Зайдите в любой супермаркет и посмотрите на этикетки продуктов питания, вы увидите, что многие из них содержат фруктозу. Даже якобы полезные фруктовые соки содержат фруктозу в качестве искусственной добавки, часто, в больших количествах.

В последние десятилетия фруктоза распространилась по всему продовольственному рынку, благодаря репутации «менее вредная, чем глюкоза». В отличие от глюкозы, фруктоза незначительно повышает уровень глюкозы в крови и секрецию инсулина. Это позволяет избежать значительных скачков уровня инсулина после потребления глюкозы, что вредно для поджелудочной железы. Кроме того, фруктоза слаще на вкус.

Сравнительно недавно, geektimes [1] опубликовал статью «Про сахара…». Помните, как говорил Штирлиц в фильме «17 мгновений весны»: «Запоминается то, что сказано в самом конце…». В этой статье (в конце главы «про фруктозу») написано: «Если есть, сколько надо … продукты с фруктозой вреда не принесут».

Аналогичными и даже более радикальными заявлениями (как правило, «безымянных авторов») буквально «забиты» социальные сети «про здоровый образ жизни». Появление новой «информации» о пользе соков, смузи, меда и сухофруктов резко «накручивает» счетчики «лайков» под публикациями. Люди, вновь и вновь, спешат «поделиться» тем, во что хочется верить самим. У многих слово «здоровье» вызывает ассоциации с фруктами, образами людей, бегущих трусцой и бутылками «ключевой» воды… Беда в том, что такая «информация» очень часто почерпнута из «мусорной» (не защищенной авторским правом) части сети Интернета и отражает лишь личное мнение неспециалиста или даже является плодом трудов «контент-мэйкера». Нужно отметить, что и статья в geektimes написана специалистом-химиком, а не медиком или биологом. А это – существенно. Не зря же существует профессиональная специализация?

А вот медики утверждают, что у фруктозы есть и «обратная сторона медали»: печень превращает фруктозу в жир очень эффективно. Люди, которые потребляют слишком много продуктов с высоким содержанием фруктозы, часто прибавляют в весе, приобретают высокое кровяное давление, инсулинорезистентность и ожирение печени — симптомы, которые врачи группируют вместе под названием «метаболический синдром».

Команда исследователей университета Базеля под руководством профессоров Кристофа Beglinger и Стефана Borgwardt завершила в 2015 г исследование того, как глюкоза и фруктоза влияют на взаимодействие желудочно-кишечного тракта и мозга [2]. Их работа финансировалась швейцарским Национальным научным Фондом.

Двенадцати здоровым молодым мужчинам давали либо фруктозу, либо глюкозу, либо плацебо через питательную трубку. У испытуемых брали образцы крови, чтобы измерить уровни гормона сытости. Испытуемые также отвечали на вопросы о том, насколько сытыми они чувствовали себя, а активность их мозга контролировалась с помощью магнитно-резонансной томографии (МРТ).

Результаты были следующими. В отличие от глюкозы, фруктоза была менее эффективна в создании чувства сытости и стимулирования системы вознаграждения в мозге. Анализ МРТ показал, что два вида сахара сильно отличались в плане активации гиппокампа и миндальных областей лимбической системы, т. е. в областей мозга, которые регулируют эмоции и ощущения. Кроме того, в отличие от глюкозы (которая стимулировала сильный сигнал) уровни гормонов сытости в крови увеличивались при потреблении фруктозы минимально. Субъективное ощущение сытости, как правило, также мало изменялось при потреблении фруктозы.


«Исследование может предоставить первые обоснованные выводы об отсутствие сытости и вознаграждающего эффекта вызванного фруктозой» – подтвердили ведущие авторы исследования д-р Беттина Wölnerhanssen и д-р Анн Кристин Мейер-Gerspach.

То есть, получается, что специалист-химик не прав: и «есть, сколько надо…» не у многих из нас получится — так уж видно мы устроены.

В июне 2015 г опубликована еще одна статья в которой Петр Mirtschink описывает еще один тревожный побочный эффект потребления фруктозы. Исследователи обнаружили ранее неизвестный молекулярный механизм, который указывает на фруктозу, как на ключевой фактор неконтролируемого роста сердечной мышцы — состояния, которое может привести к фатальной сердечной недостаточности [3].

Когда человек имеет высокое кровяное давление, сердце вынуждено расти, поскольку ему труднее прокачивать кровь через кровеносную систему. Растущие клетки сердечной мышцы требуют значительного количества кислорода. Однако, при недостатке кислорода (например, при сидячем образе жизни) клетки переключаются на альтернативное энергоснабжение. Вместо того, чтобы привлекать энергию из жирных кислот, они начинают использовать анаэробный процесс, называемый «гликолизом» (расщеплением сахаров). При этом, клетки сердечной мышцы открываются не только для глюкозы, но и для фруктозы, и это может положить начало фатальной цепной реакции.

Исследование демонстрирует, что недостаток кислорода в клетках сердца вызывает появление ФОМС-молекул. Это универсальный молекулярный переключатель, который срабатывает каждый раз, когда имеет место процесс патологического роста, например, при росте сердечной мышцы или во время рака. ФОМС-молекулы заставляют клетки сердечной мышцы производить ketohexokinase-с (ХК-С) – главный фермент в метаболизме фруктозы. ХК-C способствует усвоению фруктозы. При этом, поскольку метаболизм фруктозы не имеет никакой отрицательной регулирующей обратной связи, может возникать сердечная недостаточность.

Чтобы исследовать этот механизм, ученые использовали не только подопытных мышей, но также биологические образцы, взятые у пациентов с патологическим увеличением размеров сердца, приводившим к сужению аортального клапана. Образцы клеток сердечной мышцы, взятые хирургами во время операций на сердце, предоставили исследователям швейцарской Высшей технической школы, которые определили, что эти клетки действительно содержат молекулы ФОМС и ХК-С.

Более того, у мышей, которые страдали от хронического высокого кровяного давления, исследователи смогли «выключить» фермент ХК-С, что смогло затормозить увеличение их сердца.

Многочисленные исследования показывают, что риск от добавленного сахара может возникать именно из-за фруктозы. Но в исследовании [4], опубликованном в сентябре 2013г, сообщается, что жировая дистрофия печени и инсулинорезистентность могут стимулироваться еще и тем, что фруктоза дополнительно образуется в печени из углеводов не содержащих фруктозы.

Исследователи Мигель Lanaspa и Такудзи Ишимото сообщли, что мыши конвертируют глюкозу во фруктозу прямо в печени, и что это преобразование критическим образом способствует развитию ожирения и инсулинорезистентности у мышей, которых кормят глюкозой.

«Наши данные свидетельствуют о том, что фруктоза, полученная из глюкозы, во многом ответственна за то, что углеводы вызывают ожирение печени и инсулинорезистентность», — сказал Lanaspa.

Ричард Джонсон, доктор медицинских наук, профессор и руководитель отдела заболеваний почек и гипертонии в школе медицины Миннесоты и старший автор исследования, говорит: «Наши исследования дают понимание того, почему высокий гликемический индекс продуктов может увеличить риск ожирения и инсулинорезистентности. Значительная часть риска потребления продуктов с высоким гликемическим индексом, определяется генерацией фруктозы. Это бросает вызов догме о том, что фруктоза является безопасной».

В исследовании 2013 г, проведенном Баптистским медицинским центром Уэйк-Фореста показано, что фруктоза быстро вызывает повреждение печени даже без увеличения веса [5]. Результаты исследования опубликованы в интернет-издании «Американского журнала клинического питания».

В своем предыдущем исследовании, ученые изучали обезьян, которым разрешали есть столько, сколько они хотели нежирной пищи с добавлением фруктозы, по сравнению с контрольной группой, которую кормили пищей с низким содержанием фруктозы и низким содержанием жиров. Не удивительно, что животные на диете с высоким содержанием фруктозы приобрели на 50% больший вес, чем в контрольной группе. Уровень диабета у них в три раза превысил показатель контрольной группы. Они также приобрели неалкогольную жировую болезнь печени (стеатоз).

Большим вопросом для исследователей было то, что явилось причиной повреждения печени. Это произошло потому, что животные потолстели от переедания, или же причина в другом?

Чтобы ответить на этот вопрос, в новом исследовании были приняты меры, чтобы предотвратить увеличение веса. Десять обезьян среднего возраста и нормального веса, которые никогда не употребляли в пищу фруктозу, были разделены на две группы, сопоставимые по форме тел и окружности талии.

В течение шести недель, одна группа питалась контролируемыми по калориям продуктами, содержащими 24% фруктозы, в то время как контрольная группа питалась контролируемыми по калориям продуктами с количеством фруктозы, около 0,5%. Обе диеты имели одинаковое количество жиров, углеводов и белков, но их источники были разными,

Каждую неделю команда исследователей взвешивала животных обеих групп, измеряла окружность их талии и регулировала объем предоставляемых им продуктов так, чтобы предотвратить увеличение веса. В конце исследования ученые измерили биомаркеры повреждения печени.

«Что удивило нас больше всего — это то, как быстро печень пострадала, и насколько обширными были повреждения» — сказал руководитель исследования. «Шесть недель у обезьян примерно эквивалентны трем месяцам для организма человека. Поражение печени даже при отсутствии увеличения веса может иметь клинические последствия, поскольку большинство врачей и ученых могли думать, что именно жир в органах и вокруг органов вызывает проблемы со здоровьем».

Фруктоза в настоящее время поставляет 10% всех калорий, потребляемых гражданами США. Подростки мужского пола являются главными потребителями фруктозы, получая от 15% до 23% своих калорий из фруктозы. Это в 3 – 4 раза больше, чем максимальные уровни, рекомендованные Американской Ассоциацией Сердца и Всемирной Организацией Здравоохранения.

Недавнее исследование института передовой науки и технологий при университете штата Иллинойс [6] обнаружили, что, одни и те же количества калорий потребляемых за счет фруктозы вызывают значительно большее увеличение веса, рост физической неактивности и отложения жира, в сравнении с калориями, получаемыми из сахара или глюкозы.

Доклад «Фруктоза уменьшает физическую активность и увеличивает накопление жира в сравнении с изокалорийной диетой с применением глюкозы» был опубликован в научных трудах университета штата Иллинойс.

«Связь между увеличением потребления сахара, в частности, фруктозы, и ростом эпидемии ожирения обсуждается уже много лет без каких-либо четких выводов» — сказала Катарина Рендейро, доктор медицинских наук, ведущий специалист института передовой науки и технологий. «Реальность такова, что люди не только потребляют больше фруктозы через их диеты, но также потребляют больше калорий в целом. Однако, ключевым вопросом является: способствует ли увеличение потребления фруктозы ожирению в отсутствии чрезмерного потребления калорий?»

Исследователи под руководством Джастина Родоса, профессора университета Иллинойса, изучали две группы мышей в течение 2,5 месяцев: одна группа мышей была на диете, в которой 18% калорий поступали из фруктозы, имитируя ее потребление подростками в США. Другую группу кормили, так, чтобы 18% калорий поступали за счет глюкозы.

«Важно отметить, что животные в обеих экспериментальных группах потребляли обычный объем калорий для мышей», сказала Рендейро. «Они не ели больше, чем обычно, и обе группы имели точно такое же количество калорий, поступающих из сахара. Разница была только в типе сахара, который они получали: фруктоза или глюкоза».

Результаты показали, что у тех мышей, которых кормили фруктозой значительно увеличилась масса тела, масса печени и жировая масса по сравнению с мышами, которых кормили глюкозой.

«В предыдущих исследованиях, рост потребления фруктозы сопровождался увеличением рациона питания в целом, так что трудно было понять, животные набирают вес из-за самой фруктозы или просто потому, что они ели больше» — сказал Родос.

Примечательно, что исследователи также обнаружили, что мыши, которых кормили фруктозой, не только набирали вес, они были менее активны.

«Мы не знаем, почему животные двигаются меньше, когда в их рационе фруктоза» — сказал Родос. «Тем не менее, по нашим оценкам, снижение физической активности может содействовать увеличению веса. Биохимические факторы могут также играть роль в том, как мыши реагируют на диеты с высоким содержанием фруктозы» — объяснил Джонатан Мун, участник исследования.

«Известно, что в отличие от глюкозы, фруктоза обходит определенные метаболические шаги, которые приводят к увеличению формирования жира. Особенно это касается жировой ткани и жира в печени. Точные механизмы все еще расследуются, но одно можно сказать наверняка: высокое потребление фруктозы добавляет вес».

»Мы запланировали это исследование, основываясь на потреблении фруктозы подростками в Соединенных Штатах» — сказал Родос. «Наше исследование показывает, что уровни фруктозы действительно играют роль в увеличении веса, способствуют отложению жира, а также вносят свой вклад в физической неактивность. Учитывая резкое увеличение ожирения среди молодых людей и тяжелые негативные последствия, которые это может иметь на здоровье в течение всей их жизни, важно учитывать, какие продукты служат источниками наших калорий ».

Еще одна причина чтобы исключить фруктовые соки из вашего рациона — это подагра… по крайней мере, у мужчин старше 40 лет. Виновником является фруктоза. Подагра – это болезненный артрит, как правило, возникает в большом пальце ноги, но может проявляться и в других пальцах.

Подагра вызвана кристаллами мочевой кислоты, осаждающимися на суставах. Мочевая кислота – это побочный продукт метаболизма белков и ассоциируется с ожирением, высоким артериальным давлением, повышенным содержанием холестерина и высоким потреблением алкоголя.

Лабораторные исследования четко показали, что фруктоза повышает выработку мочевой кислоты. Вопрос в том, имеется ли в реальной жизни связь фруктозы с подагрой? Исследователи проверили это в долгосрочном наблюдении 50 тысяч медицинских работников мужского пола [7].

Оказалось, что, на самом деле, имеется связь между количеством фруктозы в рационе и шансом возникновения подагры. Две банки подслащенных безалкогольных напитков день почти в 2 раза повышают риск подагры, также как и 2 стакана фруктового сока. Фруктоза, вероятно, является более сильным фактором риска, чем алкоголь.

К счастью, целые яблоки и апельсины оказались слабо связаны с подагрой. Диетические безалкогольные напитки также оказались не связанными с этим заболеванием.

Так что же, отказаться от фруктов и всех прочих источников фруктозы?

Нет, большинство ученых считают, что ежедневное потребление НОРМАЛЬНОГО количества фруктов является безопасным и здоровым. О чем речь? Например, о том, что один стакан апельсинового сока содержит 4 апельсина, которые вы, вряд ли, употребляете за один раз в цельном виде.

А вот мнение стоматологов. В июне 2015г, отчет Королевского колледжа хирургов показал, что около 33% 5-летних в Англии страдают от кариеса[8]. Отчет государственного департамента здоровья детей, показал, что каждый год 46 000 детей госпитализируются для удаления нескольких зубов, из этого числа почти 26 000 приходится на детей в возрасте от 5 до 9 лет.

Профессор Дэмиен Walmsley, научный советник Британской стоматологической ассоциации, объясняет: «Дети сегодня перекусывают гораздо чаще, чем предыдущие поколения, что подвергает их зубы постоянным атакам».

Профессор Найджел Хант из Королевского колледжа хирургов, обвинил сладкие продукты и напитки, говоря, что их этикетки должны содержать предупреждения, аналогичные имеющимся на сигаретах, чтобы подчеркнуть риск для детских зубов.

Но проблема, конечно, не ограничивается воспитанием привычки детей к нездоровой пище. На самом деле, стоматологи говорят, что они видят больше и больше детей из семей среднего класса, чьи одержимые здоровьем родители непреднамеренно наносят вред зубам их детей.

Доктор Рона Eskander из частной стоматологической клиники в Челси, говорит, что очень часто родители с ужасом обнаруживают, что они виновны в том, что вызвали кариес у своих детей:

«Иногда спортивным детям дают ненужные «спортивные» напитки, которые содержат большое количество сахара и кислот, которые повреждают зубы» — говорит она. «Йогуртовые напитки считают здоровыми, но они, обычно, содержат высокие уровни скрытых сахаров. Мюсли и зерновые батончики часто содержат уровни сахара, вдвойне превышающие их содержание в шоколаде».

«Есть две причины, из-за которых эти продукты повреждают зубы. Первая — кислотная эрозия, которая происходит, когда зубы подвергаются воздействию кислых продуктов, таких как фрукты и соки. Сушеные фрукты (например, изюм) могут также привести к эрозии».

«Вторая причина — бактерии, которые живут во рту и выделяют кислоту, перерабатывая сахаросодержащие продукты. Эта кислота атакует эмаль точно так же, как при потреблении фруктов. Эти бактерии любят сахар-рафинад, но они также питаются медом, и даже сахарами, получающимися в результате переработки крахмалистых продуктов, таких как хлеб».

Зубная эмаль начинает размягчаться, когда кислотный уровень слюны во рту ниже 5,5 по шкале рН. (вода имеет рН 7, апельсины — от 3 до 4). От 30 минут до часа, слюна, которая является щелочной, восстанавливает естественный баланс рН в полости рта и эмаль твердеет. Но если воздействие кислоты происходит слишком часто (например, при регулярных «перекусах») эмаль начинает стираться. Это делает зубы более уязвимыми, особенно, если зубы чистить щеткой в течение 30 минут после кислотного воздействия. Смягченная эмаль может быть буквально удалена.

«Кислотные атаки могут длиться до часа, но зубы могут восстановиться, если вы ограничите потребление сладких продуктов и напитков только тремя приемами пищи» — говорит профессор Walmsley.

Мода на коктейли тоже не проходит даром. Д-р Uchenna Окойе из Лондонской стоматологической клиники «Улыбка» предупреждает: «Сок из плодов имеет высокое содержание кислоты и может повредить эмаль зубов точно так же, как газированные напитки».

[1] geektimes.ru/post/260084

[2] medicalxpress.com/news/2015-06-fructose-brain-reward-lesser-degree.html

[3] medicalxpress.com/news/2015-06-fructose-powers-vicious-circle.html

[4] medicalxpress.com/news/2013-09-link-obesity-body-production-fructose.html

[5] medicalxpress.com/news/2013-06-dietary-fructose-liver-animal.html

[6] www.eurekalert.org/pub_releases/2015-06/bifa-r…

[7] www.abc.net.au/health/minutes/stories/2008/03…

[8] www.dailymail.co.uk/health/article-3192993/A-b…

Фруктоза наступает — Антифитнес Игоря Шишко

Фруктоза наступает!

Наступают ожирение и сахарный диабет второго типа. Причем наступает опасно, под видом продуктов для похудения и сахарозаменителей. Почему? Потому что, как всегда, наш народ хочет халявы. «И рыбку съесть и на х.. сесть» — любимая мечта нашего народа. Что хотят есть все толстые худеющие? Они хотят есть вкусное и сладкое, но не толстеть.Что хотят девочки сидящие на #пп и прочей хрени? Есть вкусняшки и не толстеть.

О чем мечтают молодые худосочные (похожие на геев) хипстеры, свэги и прочие доходы? Немного подкачать мышцы и иметь рельефный прессик, кубики на животе. Они этим меня достали в клубе. Но все знают, что от сладкого растет жир. А есть сладкое и вкусное, ох как хочется.

Вот здесь и появляются продукты типа фитнес и #пп, которые обещают чудо и бесплатный сыр. Но как известно чудес не бывает, есть просто «химия», а бесплатный сыр только в мышеловке.

Итак представляю вашему вниманию бесплатный сыр из мышеловки — фруктозу

Она может скрываться под разными именами: арабино-гексулоза, левулёза, кетогексоза, кетоноспирт (многие производители любят маскировать названия сахаров под другие названия). Но все это фруктоза или фруктовый сахар.

  • Фруктоза — изомер глюкозы. Это когда молекула состоит из тех же атомов, но имеет другую пространственную форму. Фруктоза в 2 раза слаще глюкозы и в 4-5 раз слаще лактозы

В живых организмах присутствует исключительно D-изомер, в свободном виде — почти во всех сладких ягодах и плодах — в качестве моносахаридного звена входит в состав сахарозы и лактулозы.

  • Калорийности 100 грамм фруктозы — 399 кКал (для сравнения сахар 378 кКал)

Молекула сахарозы (пищевого сахара) состоит из двух простых сахаридов: глюкозы и фруктозы.

Теперь история, как все начиналось и немного упрощенной (а значит не совсем правильной) теории. Формулы я писать не буду, это дело неблагодарное, но если кому интересно, все есть в сети.

Глюкоза при попадании в кровь вызывает выброс инсулина. Как известно именно инсулин помогает организму утилизировать глюкозу. В мышцы, как энергетик при физческой нагрузке, в гликоген после нагрузки или включает один из механизмов ожирения. Грубо говоря инсулин «превращает» глюкозу в жир.

Ещё раз, для тех, у кого мозг ослаблен постами из Инстаграмм:

  1. Если есть физическая нагрузка, инсулин «превращает» глюкозу в энергию или гликоген мышц.
  2. Если нет нагрузки, инсулин превращает глюкозу в запас энергии — жир.

Фруктоза при попадании в организм не дает такого большого выброса инсулина. А нет инсулина — нет жира. Казалось-бы ура, Волшебный сахар найден!

Ешь вкусное-сладкое калорийное и не толстей. Но не радуйтесь так сильно, даже с точки зрения теории КБЖУ, которую я считаю не совсем правильной. Не забываем калорийность фруктозы больше сахара. Калорийность сахара — 378 кКал, фруктозы — 399 кКал. Теоретически конфеты, печенья и тортики на фруктозе не превращаются в жир, да и вообще безвредны для фигуры.

И пошло-поехало. Сначала фруктоза стала продаваться как схарозаменитель для сладкоежек-диабетиков, а затем и для всех занимающихся фитнесом, сидящих на #пп и просто модных. Фруктоза пошла в наступление по миру.

  • Фитнес сладости на фруктозе
  • Конфеты на фруктозе
  • Фитнес-каши на фруктозе

Кстати в той самой пресловутой Кока-Коле, которую нельзя пить худеющим, фруктоза или фруктозно-глюкозный сироп а не сахар. Теоретически можно сказать, что она действительно без сахара, в смысле сахарозы. В общем решили, что волшебный сахар для похудения и #пп найден.

Но ожирение продолжало наступать, вес народа продолжал увеличиваться. Стали проводить новые исследования и все оказалось не так просто.

Да, фруктоза действительно не поднимает очень сильно уровень сахара (глюкозы) в крови, но все-таки поднимает. Часть фруктозы наш организм превращает в глюкозу. Ну а дальше пошло самое интересное, фруктоза превращается в жир!

Кому интересны подробности смотрим здесь усвоение фруктозы и глюкозы.

Именно фруктоза стимулирует процессы ожирения.

Причем не только у человека, у всех животных северного полушария. По одной из теорий, это последствия древнего оледенения. Климат поменялся и смогли выжить только те виды, которые научились запасать сахар (в виде жира). Причем запасать столько, сколько животное в состоянии сожрать. Осенью, когда созревают плоды и ягоды, все животные (особенно впадающие в спячку) начинают усиленно поедать плоды и ягоды содержащие фруктозу.

Как работает механизм ожирения на фруктозе?

В нашем организме есть два  хитрых гормона, грелин и лептин. Грелин это по сути гормон голода стимулирующий аппетит. Лептин — гормон сытости, подавляющий аппетит. Эти два гормона работают по принципу качелей, растет уровень одного, падает уровень другого. Обмен веществ нашего организма всегда стремится к равновесию.

Предельно упрощаю и опускаю все подробности.

Если мы едим сладости, торты, пирожное или шоколад в крови растет уровень глюкозы. Механизм усвоения глюкозы имеет обратную связь. Растет уровень глюкозы — растет уровень лептина (гормона сытости) и понижается уровень грелина (гормона голода). Поэтому съесть торт целиком или плитку шоколада за раз, может не каждый, затошнит. Тошнота от сладкого, это один из признаков работы этого гормона.

Если мы едим фрукты или продукты на фруктозе в крови растет уровень фруктозы. Но механизм усвоения фруктозы не имеет обратной связи, гормон голода не подавляется. А есть исследования подтверждающие обратное, фруктоза стимулирует синтез гормона голода и подавляет синтез гормона сытости.

С точки зрения выживания в первобытном лесу при Ледниковом периоде все логично. Если вдруг вечно голодный и работающий на пределе физических и моральных сил первобытный человек набредал на полянку сезонных диких ягод или фруктов, природа заставляла его съесть все что можно. И всю фруктозу превратить в энергетические консервы — жир.

С тех давних времен наш обмен веществ не поменялся. Природа не знала, что пройдет время и путем генетических мутаций человек создаст современные фрукты, которые по содержанию сахаров очень далеко ушли от своих диких предков, а чистую фруктозу будет жрать просто ложками.

Новое исследование, проведенное учеными из Калифорнийского университета показало, что фруктоза может повредить сотни генов в головном мозге. Эти гены связаны со многими болезнями: от диабета и сердечно-сосудистых заболеваний до болезни Альцгеймера и синдрома дефицита внимания и гиперактивности. Сведения о вреде фруктозы имеют огромное значение, так как этот подсластитель в том или ином виде употребляют все люди. Фруктоза содержится в большинстве видов детского питания и фруктах.

Таким образом фруктоза создает серьезную опасность для организма. Возможно, современная распространенность заболеваний мозга и обмена веществ во многом связаны с ростом потребления фруктозы.

comments powered by HyperComments

Инфо Поле » Фруктоза и ожирение

В последнее время все чаще можно увидеть людей, которые отказались от сахара. Ведь его чрезмерное употребление приводит к ожирению, вызывает кариес и даже может стать причиной сахарного диабета. Однако некоторые люди, исключая из своего рациона сахар, заменяют его на аналоги. Считается, что это поможет справиться с сопутствующими обычному сахару проблемами. Во многих случаях это действительно так. Но, чтобы заменить сахар, важно разобраться в пользе и возможных рисках аналогов. Сегодня мы разберем один из подсластителей, который часто используют как замену традиционного сахара. Речь пойдет о фруктозе.

Фруктоза – натуральный сахарозаменитель. На умы некоторых людей прилагательное «натуральное» оказывает фантастическое воздействие: многие считают, что такой подсластитель не оказывает никаких негативных эффектов, он не имеет «побочек» и допустим практически в любых дозах. Так это или нет, попробуем разобраться в нашей статье.

Что такое фруктоза?

Фруктоза представляет из себя моносахарид, который входит в состав привычного нам сахара. При соединении фруктозы и глюкозы получается сахароза, которая есть почти в каждом доме.

Отдельно фруктозу можно встретить во многих фруктах, именно она и придает им сладковатый вкус. Содержание фруктозы в плодах относительно невелико, к тому же она непосредственно связана с клетчаткой, что делает ее отрицательное влияние на организм минимальным. Если же употреблять фруктозу в чистом виде, это может привести к целому ряду последствий и вот почему.

Почему фруктоза вредна для организма

Глюкоза необходима всем системам организма для поддержания жизнедеятельности, она метаболизируется для дальнейшего получения энергии. Этого нельзя сказать о фруктозе, ведь ни мышцы, ни мозг, ни прочие ткани метаболизировать ее не умеют. Эту функцию берет на себя печень, которая не предназначена для переработки большого количества фруктозы. Лишь малая часть фруктозы в печени превращается в глюкозу, остальное же идет на образование висцерального жира. Висцеральное ожирение нарушает работу внутренних органов и увеличивает риск развития таких серьезных заболеваний, как сахарный диабет II типа и рак.

Ожирение и перебои в работе печени – лишь начало более серьезных заболеваний. На сегодня картина влияния чистой фруктозы на организм открыта не полностью, однако уже есть масса всевозможных экспериментов, подтверждающие негативное влияние чрезмерного употребления данного заменителя сахара.

  • Фруктоза может повысить уровень холестерина, что приведет к накоплению висцерального жира вокруг органов и, возможно, к сердечным заболеваниям1.

  • Фруктоза увеличивает уровень мочевой кислоты в крови, что приводит к подагре и повышению артериального давления2.

  • Фруктоза вызывает отложение жира в печени, что может привести к жировой болезни печени3.

  • Фруктоза не дает того чувства сытости, что может дать обычный сахар. Результатом этого может стать еще большее переедание фруктозы4.

  • Фруктоза вызвать резистентность к инсулину, что может привести к ожирению и диабету II типа5.

Фруктоза в фруктах

Не стоит сразу же бросать все фрукты, только узнав о вреде фруктозы. Все эти побочные эффекты можно наблюдать в случаях превышения нормы фруктозы, которая составляет 35-50 г в сутки для взрослого человека. Во всех фруктах содержится небольшое ее количество, что в совокупности с клетчаткой, делает перенасыщение фруктозой практически невозможным.

Альтернативой фруктозе и белому сахару могут стать другие заменители сахара. Например, эритрит или сукралоза.


1 Kimber L. Stanhope, Jean Marc Schwarz, Nancy L. Keim, Steven C. Griffen, Andrew A. Bremer, James L. Graham, Bonnie Hatcher, Chad L. Cox, Artem Dyachenko, Wei Zhang,6 John P. McGahan, Anthony Seibert, Ronald M. Krauss, Sally Chiu, Ernst J. Schaefer, Masumi Ai, Seiko Otokozawa, Katsuyuki Nakajima, Takamitsu Nakano, Carine Beysen, Marc K. Hellerstein, Lars Berglund, and Peter J. Havel, «Consuming fructose-sweetened, not glucose-sweetened, beverages increases visceral adiposity and lipids and decreases insulin sensitivity in overweight/obese humans», J Clin Invest. 2009 May 1; 119(5): 1322–1334

2 Nakagawa T, Hu H, Zharikov S, Tuttle KR, Short RA, Glushakova O, Ouyang X, Feig DI, Block ER, Herrera-Acosta J, Patel JM, Johnson RJ, «A causal role for uric acid in fructose-induced metabolic syndrome», Am J Physiol Renal Physiol. 2006 Mar;290(3):F625-31. Epub 2005 Oct 18

3 Jegatheesan P, De Bandt JP, «Fructose and NAFLD: The Multifaceted Aspects of Fructose Metabolism», Nutrients. 2017 Mar 3;9(3)

4 Page KA, Chan O, Arora J, Belfort-Deaguiar R, Dzuira J, Roehmholdt B, Cline GW, Naik S, Sinha R, Constable RT, Sherwin RS, «Effects of fructose vs glucose on regional cerebral blood flow in brain regions involved with appetite and reward pathways», JAMA. 2013 Jan 2;309(1):63-70

5 Baena M, Sangüesa G, Dávalos A, Latasa MJ, Sala-Vila A, Sánchez RM, Roglans N, Laguna JC, Alegret M, «Fructose, but not glucose, impairs insulin signaling in the three major insulin-sensitive tissues», Sci Rep. 2016 May 19;6:26149

Фруктоза, но не глюкоза, нарушает передачу сигналов инсулина в трех основных чувствительных к инсулину тканях.

Животные и диета

Самок крыс Sprague-Dawley, полученных из Charles River (Барселона, Испания), использовали для всех экспериментов. Крыс содержали в условиях постоянной влажности (40–60%) и температуры (20–24 °) с 12-часовым циклом свет / темнота. Процедуры проводились в соответствии с «Принципами ухода за лабораторными животными» (публикация NIH № 85–23, пересмотренная в 1985 г.) и в соответствии с руководящими принципами, установленными Комитетом по биоэтике Барселонского университета (Закон об автономном правительстве Каталонии 5/1995, 21 июля. ).Все экспериментальные процедуры с участием животных были одобрены Этическим комитетом экспериментов на животных Университета Барселоны (разрешение № 5448).

Эксперимент 1

20 крыс в возрасте 8 недель были случайным образом распределены либо в контрольную группу (без дополнительного сахара, n = 8), либо в группу с добавлением фруктозы (10% мас. / Об. В питьевой воде) (n = 12) для 2 месяца 14 . В конце вмешательства, после 2-часового голодания, животных анестезировали изофлураном, а кровь, взятую из воротной вены печени, собирали в пробирки, не содержащие эндотоксинов.Затем крыс умерщвляли обескровливанием, собирали образцы печени и хранили, как описано 15 . Собирали икроножную мышцу обеих ног и висцеральную белую жировую ткань (vWAT, включая забрюшинную, периренальную и перигонадальную жировую ткань), немедленно замораживали в жидком азоте и хранили при -80 ° C до тех пор, пока они не понадобились.

Эксперимент 2

Другая группа крыс использовалась для выполнения теста толерантности к глюкозе (GTT) и изучения их реакции на введение болюса инсулина.Продолжительность исследования была такой же, как указано выше, но экспериментальный план также включал группу, получавшую раствор глюкозы (n = 10 животных / группу). Потребление жидкости и пищи измеряли каждый день, рассчитывали потребление калорий и рассчитывали концентрацию раствора глюкозы, который должен быть приготовлен на следующий день, чтобы соответствовать количеству калорий, потребленных группой фруктозы.

GTT был выполнен, как описано 10 , с некоторыми изменениями. Вкратце, после 6-часового голодания крыс анестезировали и после взятия необработанного образца (время 0) в брюшную полость вводили раствор глюкозы 2 г / кг веса тела.Во время теста кровь брали из хвостовой вены через 15, 30, 60, 90 и 120 минут после введения глюкозы. Измерения уровня глюкозы проводились с помощью портативного глюкометра. Уровни инсулина в плазме измеряли на исходном уровне, через 15 и 120 минут после введения глюкозы с использованием набора для ELISA для крысиного инсулина (Millipore, Billerica, MA). Значения площади под кривой (AUC) для концентраций глюкозы и инсулина рассчитывались трапециевидным методом с использованием 0 в качестве базовой линии.

Через неделю после GTT 12-часового голодания животных анестезировали кетамином: ксилазином (90:10 мг / кг массы тела) и внутрибрюшинно вводили 0.15 единиц инсулина / г массы тела (Humulina® Regular, Лилли, Мадрид, Испания) 16 900 10. Через 15 минут кровь была взята из воротной вены печени, а образцы из печени, икроножной мышцы и vWAT были собраны, как описано для эксперимента 1.

Анализ липидов крови / плазмы и инсулина

Триглицериды крови были измерены с использованием системы Accutrend® Plus глюкометр (Cobas, Roche Farma, Барселона, Испания). Холестерин плазмы определяли с помощью колориметрического теста Cholesterol CHOD-POD N ° 1001091 (Spinreact, Girona, Испания).Неэтерифицированные жирные кислоты (NEFA) определяли с помощью колориметрического ферментативного анализа на планшете (5620-01) от Bioo Scientific (Остин, Техас, США). Концентрации инсулина в плазме определяли с использованием набора для иммуноферментного анализа (Millipore, Billerica, MA).

Количественное определение аланинаминотрансферазы (АЛТ)

Для определения активности АЛТ в образцах плазмы мы использовали набор ALT / GPT Spinreact от Spinreact (Жирона, Испания), основанный на определении скорости снижения концентрации НАДН, измеренной фотометрическим методом. .

Липидомный анализ состава жирных кислот триглицеридов печени

Липиды печени экстрагировали и анализировали, как описано ранее 17 . Для определения жирных кислот к образцам гомогенатов печени добавляли внутренний стандарт триглицерида C15: 0 с последующей экстракцией общего липидного материала хлороформом / метанолом (2: 1 об. / Об.). Триглицериды выделяли твердофазной экстракцией, как описано в Burdge et al . 18 . Метиловые эфиры жирных кислот получали инкубацией с подкисленным метанолом и разделяли с помощью газовой хроматографии на газовом хроматографе Agilent 7890 HP 6890, оборудованном 30 м × 0.Капиллярная колонка SupraWAX-280 25 мкм × 0,25 мм (Teknokroma, Барселона, Испания), автоматический пробоотборник и пламенно-ионизационный детектор. Активность стеароил-КоА-десактуразы (SCD1) рассчитывалась как отношение концентраций пальмитолеиновой кислоты к концентрациям пальмитиновой кислоты в триглицеридах печени (C16: 1 n-7 / C16: 0), поскольку этот индекс более точно отражает экспрессию SCD1 в печени, чем соотношение олеиновой и стеариновой кислот кислота 19 .

Анализ эндотоксинов

Образцы крови из воротной вены печени, собранные в пробирки без эндотоксинов, нагревали при 70 ° C в течение 5 минут.Уровни эндотоксинов в плазме измеряли с помощью анализа лизата амебоцитов limulus в диапазоне концентраций 0,015–1,2 ЕС / мл (Charles River, L’Arbresle, Франция).

Гистологические исследования

Некроз и фиброз анализировали на срезах печени, окрашенных гематоксилин-эозином и трихромовой кислотой соответственно. Изображения, полученные с помощью микроскопа Olympus BX43, были интерпретированы в BioBanc (Banc de tumors-IDIBAPS, Барселона, Испания).

Получение и анализ РНК

Общую РНК выделяли с использованием реагента TrizolR (Invitrogen, Carlsbad, CA, USA) в соответствии с инструкциями производителя.Концентрацию и чистоту РНК измеряли спектрофотометрически с использованием спектрофотометра NanoDrop® ND-1000 (Thermo Scientific). Соотношение абсорбций 260/230 и 260/280 использовали в качестве индикаторов чистоты РНК. Целостность РНК определяли, прогоняя образцы на 1% агарозных гелях, окрашенных бромидом этидия. Качество РНК проверяли по наличию четких полос 28S и 18S рРНК в соотношении 2: 1. Специфические мРНК оценивали с помощью полимеразной цепной реакции с обратной транскрипцией в реальном времени (RT-PCR) с использованием SYBR green PCR Master Mix, специфических праймеров и системы обнаружения последовательности Applied Biosystems One-Step Plus (Applied Biosystems, Foster City, CA, USA).В качестве внутреннего контроля использовали связывающий белок ТАТА-бокс (tbp). Последовательности праймеров и длина продукта ПЦР перечислены в дополнительной таблице 1.

Анализ микроРНК

Полную РНК, включая малые РНК, выделяли с использованием мини-набора miRNeasy (Qiagen). Для количественной оценки экспрессии микроРНК (miRNA) miRNA подвергали обратной транскрипции с использованием набора для обратной транскрипции miScript II (Qiagen). Для каждой miRNA (Qiagen) использовали специфические праймеры, и проводили ПЦР в реальном времени с использованием набора miScript SYBR Green PCR (Qiagen) в системе 7900 HT Fast Real-Time PCR System (Applied Biosystems).Относительное выражение рассчитывали методом 2 -ΔΔCt с использованием RNU6 для нормализации. Были проанализированы только миРНК, подтвержденные для генов-мишеней. Выбор подтвержденных miRNA оценивался с использованием баз данных MirWalk 3 20 и miRTarbase 4 21 .

Приготовление белковых экстрактов

Экстракты общих и ядерных белков из печени и мышц получали методом Хелениуса 22 . Образцы жировой ткани микронизировали путем замораживания жидким азотом и измельчения в ступке.Для экстракции общего белка используйте буфер для лизиса с протеазами, фосфатазами и ингибиторами ацетилазы (50 мМ Tris – HCl pH = 8, 150 мМ NaCl, 1% Igepal, 10 мМ NaF, 1 мМ EDTA, 1 мМ EGTA, 2 мМ Nappi, 1 мМ PMSF, 2 мкг / мл лейпептина, 2 мкг / мл апротинина, 1 мМ Na3VO4, 10 мМ NaM, 1 мкМ TSA) добавляли к микронизированной ткани и гомогенизировали в течение 1,5 ч при 4 ° C. Затем образцы центрифугировали при 15000 × g в течение 15 мин при 4 ° C и собирали супернатант. Концентрации белка определяли по методу Брэдфорда 23 .Для обнаружения транслокации белка GLUT4 на плазматическую мембрану субклеточную фракцию, обогащенную белками плазматической мембраны, получали из образцов мышц крысы путем последовательного центрифугирования 24 .

Вестерн-блоттинг

30 мкг различных белковых фракций из тканей крысы подвергали электрофорезу в SDS-полиакриламидном геле. Затем белки переносили на мембраны для переноса поливинилидендифторида Immobilon (Millipore, Billerica, MA, USA), блокировали в течение 1 ч при комнатной температуре 5% обезжиренным молочным раствором в 0.1% Твин-20-Трис-забуференный физиологический раствор (TBS) и инкубировали, как описано ранее 15 . Детекцию проводили с использованием набора для хемилюминесценции ECL для HRP (Amersham GE Healthcare Europe GmbH, Барселона, Испания). Для подтверждения однородности белковой нагрузки блоты инкубировали с антителами к β-тубулину или β-актину (Sigma-Aldrich, Сент-Луис, Миссури, США) в качестве контроля. Первичные антитела к фосфо- и общему AKT, фосфо- и общему AS160, фосфо-ERK, GLUT4, фосфо-PKA и фосфо-TSC-2 были предоставлены компанией Cell Signaling (Данверс, Массачусетс, США), антитела к 14-3-3 , ChREBP, фосфо- и общий FoxO1, IRS-1, IRS-2, MKP-3 и фосфо-SGK-1 были получены от Santa Cruz Biotechnologies (Даллас, Техас, США), а антитела против фосфо-mTOR были от Millipore (Billerica , Массачусетс, США).

Статистический анализ

Результаты выражаются как среднее из n значений ± стандартное отклонение. Образцы плазмы анализировали в двух экземплярах. Гауссовское распределение данных было проверено с использованием теста нормальности Колмогорова-Смирнова, а значимые различия были установлены с помощью двустороннего непарного t-критерия, теста ANOVA или непараметрического теста, в зависимости от ситуации (GraphPad Prism Software V5). Уровень статистической значимости был установлен на уровне p ≤ 0,05.

Новая теория возникновения инсулинорезистентности и метаболических заболеваний

ДУРЭМ, Н.C. — Вызывает ли чрезмерное употребление сахара сахарный диабет 2 типа?

Ответ может быть непростым, но исследование, опубликованное 26 сентября в «Журнале клинических исследований», дополняет растущее количество исследований, связывающих чрезмерное потребление сахара, особенно сахарной фруктозы, с ростом метаболических заболеваний во всем мире.

Исследование, проведенное на мышах и подтвержденное образцами печени человека, раскрывает метаболический процесс, который может опровергнуть предыдущие представления о том, как организм становится устойчивым к инсулину и в конечном итоге развивается диабет.

По данным Центров по контролю и профилактике заболеваний, рост распространенности диабета считается эпидемией здравоохранения, поскольку более 29 миллионов человек в США страдают диабетом, а еще 86 миллионов — преддиабетом.

«До сих пор существуют серьезные разногласия относительно того, является ли потребление сахара основным фактором развития диабета», — сказал старший автор Марк Херман, доктор медицины, доцент кафедры эндокринологии, метаболизма и питания Медицинской школы Университета Дьюка.

«Некоторые исследователи утверждают, что обычно потребляемое количество сахара не способствует этой эпидемии», — сказал Герман. «В то время как другие убеждены, что чрезмерное употребление сахара является основной причиной. В этой статье раскрывается особый механизм, с помощью которого потребление фруктозы в больших количествах, например, в газировке, может вызвать проблемы ».

Инсулин — ключевой гормон, регулирующий уровень глюкозы в крови после еды. Инсулинорезистентность, когда метаболические ткани организма перестают нормально реагировать на инсулин, является одним из самых ранних обнаруживаемых изменений при прогрессировании диабета.

Однако, согласно этому исследованию, причина инсулинорезистентности может иметь мало общего с дефектами передачи сигналов инсулина и на самом деле может быть вызвана отдельным процессом, запускаемым избытком сахара в печени, который активирует молекулярный фактор, известный как элемент, чувствительный к углеводам. -связывающий белок, или ChREBP.

Белок ChREBP обнаружен в нескольких метаболических органах мышей, людей и других млекопитающих. В печени он активируется после употребления фруктозы — формы сахара, которая естественным образом содержится во фруктах и ​​овощах, но также добавляется во многие обработанные пищевые продукты, включая безалкогольные напитки.Исследование показало, что фруктоза запускает процесс, заставляющий печень вырабатывать глюкозу и повышать уровень глюкозы в крови, даже когда инсулин пытается контролировать производство глюкозы.

«В течение последних нескольких десятилетий исследователи предполагали, что должна быть проблема в том, как печень воспринимает инсулин, и именно поэтому инсулинорезистентные люди производят слишком много глюкозы», — сказал Херман. «Мы обнаружили, что независимо от того, сколько инсулина вырабатывает поджелудочная железа, она не может преодолеть процессы, запускаемые этим белком, ChREBP, для стимуляции выработки глюкозы.Это в конечном итоге приведет к повышению уровня сахара в крови и уровня инсулина, что со временем может привести к инсулинорезистентности в других частях тела ».

Герман впервые в Duke и в течение последних четырех лет руководил исследованиями в Медицинском центре Beth Israel Deaconess при Гарвардском университете с сотрудниками из Медицинской школы Массачусетского университета и Pfizer Inc.

Чтобы проверить свою гипотезу, исследователи изучали мышей, которые были генетически изменены таким образом, чтобы их сигнальные пути инсулина в печени были максимально активированы — другими словами, их печень не должна была производить глюкозу.

Исследователи обнаружили, что даже у этих мышей употребление фруктозы запускало связанные с ChREBP процессы в печени, заставляя ее производить все больше и больше глюкозы, несмотря на то, что сигналы инсулина приказывали ей остановиться.

Предыдущие исследования показали, что диета с высоким содержанием фруктозы может вызывать множественные метаболические проблемы у людей и животных, включая резистентность к инсулину и жировую болезнь печени. Поскольку у большинства инсулинорезистентных людей также наблюдается ожирение печени, многие исследователи предположили, что жировая дистрофия печени, вызванная фруктозой, приводит к дисфункции печени, что вызывает резистентность к инсулину, диабет и высокий риск сердечных заболеваний.

Новые данные показывают, что жировая болезнь печени может быть отвлекающим маневром, сказал Херман. Вероятной причиной инсулинорезистентности может быть не накопление жира в печени, как это принято считать, а скорее процессы, активируемые ChREBP, которые затем могут способствовать развитию ожирения печени и увеличению выработки глюкозы.

Хотя требуется гораздо больше исследований, ученые считают, что они лучше понимают ключевой механизм, ведущий к предиабету, и теперь могут изучить, как, возможно, прервать эту цепочку событий.По словам Германа, ChREBP может быть не единственным путем, по которому это происходит, и белок также может быть активирован другими способами. Но исследование дает важную информацию, сказал он.

«Это дает нам некоторое представление о том, что может происходить на ранних стадиях диабета», — сказал Герман. «Если мы сможем разработать лекарства, нацеленные на этот процесс, это может быть способом предотвратить его на ранней стадии развития болезни».

Открытие также может помочь ученым однажды диагностировать метаболические нарушения на более раннем этапе, потенциально позволяя пациентам раньше вносить изменения в свой рацион и образ жизни, чтобы предотвратить более серьезные осложнения.

Как врач, Герман сказал, что совет пациентам остается прежним: убедитесь, что вы не едите слишком много сахара, который часто отображается на этикетках как сахароза (основной ингредиент свеклы и тростникового сахара) и кукурузный сироп с высоким содержанием фруктозы. . По его словам, оба подсластителя содержат глюкозу и фруктозу и быстро всасываются.

В своей естественной форме и количестве фруктоза не особенно вредна, объяснил Герман, потому что, например, если вы едите яблоко, вы едите относительно небольшое количество сахара, и он сочетается с другими питательными веществами, такими как клетчатка, которая может замедлить его абсорбцию.

«Вы можете съесть три яблока и не получить столько же фруктозы, сколько из 20 унций сахаросодержащего напитка», — сказал он. «Основными источниками чрезмерного количества фруктозы являются такие продукты, как газированные напитки и многие обработанные пищевые продукты, которые, по мнению большинства врачей, ограничивают в своем рационе».

Помимо Германа, авторами исследования являются Ми-Сунг Ким; Сара А. Кравчик; Людивин Доридот; Алан Дж. Фаулер; Дженнифер X. Ван; Суня А. Траугер; Хе-Лим Но; Хи Джун Кан; Джон К.Мейсен; Мэтью Блатник; Джейсон К. Ким; и Мишель Лай.

Исследование было поддержано Национальными институтами здравоохранения (P30DK057521, R01DK100425, T32DK007516, K23DK083439). Часть исследования была проведена в Национальном центре метаболического фенотипирования мышей при Массачусетском университете при финансовой поддержке NIH (UC2 DK093000). Двое из авторов, Мейсен и Блатник, ссылались на работу в Pfizer Inc. в своих сообщениях о конфликте интересов и раскрытии финансовой информации.

Фруктоза не вызывает диабета.

Я не согласен с Гэри Таубсом, которого я очень уважаю. Давайте проанализируем это физиологически, а не эпидемиологически. Скользкая дорожка между «ассоциированным» и «вызванным» слишком знакома.

Глюкоза:

Г-н Таубс говорит о «отделении любого вредного воздействия сахара от вредного воздействия содержащихся в нем калорий», но его не беспокоит, казалось бы, приятный компаньон фруктозы — глюкоза. В конце концов, те бета-клетки, которые попадают в организм при диабете, созданы, чтобы справляться с глюкозой, а не с фруктозой.

Обычно диабет 2 типа связывают с ожирением и инсулинорезистентностью. Фактически, некоторые заходят так далеко, что говорят, что инсулинорезистентность — это диабет 2 типа. Однако, хотя резистентность к инсулину действительно вызывает повышение уровня глюкозы в крови, это не основная проблема; именно мертвые бета-клетки являются необратимой и прогрессирующей сущностью диабета 2 типа. Инсулинорезистентность — это просто обратимая адаптация к слишком большому количеству глюкозы в крови, слишком часто; вызывая хроническое перенасыщение мышечных клеток и топливного бака печени глюкозой.Резистентность к инсулину была названа злодеем диабета 2 типа, потому что он казался болезненным, в то время как повсеместное потребление пищевых углеводов (глюкозы) казалось естественным.

Ожирение так часто бросается в глаза при наблюдении за пациентами с диабетом 2 типа, что эта связь кажется причинной, но многие безуспешно пытались физиологически связать ожирение с диабетом 2 типа. Одно не вызывает другого, но у них есть общий предшественник, диетическая глюкоза, как по количеству, так и по кратковременным пиковым эффектам.

Эволюция человека предполагает, что почти вся глюкоза будет постепенно высвобождаться из печени по мере необходимости. Таким образом, уровень глюкозы в крови никогда не повышается очень сильно или очень быстро, и наши бета-клетки никогда не подвергаются перенапряжению. Но, когда вы едите углеводы, уровень глюкозы в крови резко и быстро повышается, вызывая массивную и быструю секрецию инсулина; и даже временные пики, неизвестные в ходе эволюции, кажутся огромной нагрузкой глюкозы на бета-клетки, которые затем пытаются ответить избыточной выработкой инсулина. Инсулинорезистентность в печени и мышцах еще больше усугубляет это, требуя еще большего количества инсулина, чтобы заставить еще больше глюкозы.

Это угрожает самому выживанию наших бета-клеток. Основным триггером апоптоза является неспособность клетки выполнять свою функцию, но требование, чтобы бета-клетки массово и быстро секретировали инсулин, приводит их к неудаче и запускает апоптоз. Большинство бета-клеток диабета 2 типа страдают апоптозом, то есть диабетом.

Если через восемь часов после еды поджелудочная железа не может обеспечить достаточное количество инсулина, чтобы снизить уровень глюкозы в крови натощак ниже 90, должно быть несколько выживших бета-клеток — и теперь каждого из этих немногих выживших просят секретировать еще больше инсулина.Таким образом, лавинообразный эффект, меньшее количество бета-клеток, большее количество требуемых от каждой клетки, более быстрый апоптоз — прогрессивное ухудшение диабета.

Лечение: в течение одного месяца уменьшите количество углеводов почти до нуля. Спасайте вышедшие из строя бета-клетки, вводя инсулин во время их восстановления.

Фруктозы:

Это обвинение в применении глюкозы при диабете 2 типа не позволяет избежать употребления фруктозы при НАЖБП и атеросклерозе. Фруктоза вызывает de novo липогенное производство ЛПОНП (триглицеридов), вызывающих ожирение печени, и с помощью CETP производит маленькие плотные частицы ЛПНП, способные пробивать эндотелий артерий и, при участии иммунной системы, вызывать атеросклероз.

Хронически повышенный уровень глюкозы может иметь аналогичный эффект — следите за обновлениями.

Адаптировано (со слишком ограниченным контекстом) из моей текущей статьи «Единая физиология ожирения и метаболического синдрома».

[email protected]

Избыточная фруктоза и инсулинорезистентность — новая связь

Мы наблюдаем рост числа случаев инсулинорезистентности, диабета 2 типа и нарушений обмена веществ во всем мире. В 2015 году каждый одиннадцатый человек в мире болел диабетом (и это только те, о которых мы знаем!). 1

В Австралии известно 1,7 миллиона случаев диабета, из которых 85% приходится на диабет 2 типа. 2 И, как мы знаем, осложнения могут включать потерю зрения, диализ и ампутацию, если их не остановить. 3 Не весело.

Многие медицинские работники и исследователи понимают, что существует тесная связь между диетой, выбором образа жизни и развитием заболевания.

Мало движения и много еды, кажется, коррелируют с метаболической дисфункцией, а недостаток сна, стресс и генетика также могут сыграть свою роль.Скажем так, разбивание 5 бутылок кока-колы, 3 батончиков Mars, миски Nutri-Grain и полировки тарелки жареной колбасы и чипсов каждый день не может помочь чьему-либо телу оптимально функционировать.

Постоянное и высокое потребление свободных сахаров и вредных трансжиров может привести к высоким и колебаниям уровня глюкозы в крови и увеличению выработки воспалительных цитокинов и свободных радикалов. Считается, что это способствует изменению сигнализации и чувствительности к инсулину, чрезмерному воспалению и повреждению тканей по всему телу. 4-5

Однако новое исследование обнаружило совершенно другой механизм, при котором чрезмерное потребление свободного сахара — особенно фруктозы — может способствовать избыточному производству глюкозы и инсулинорезистентности, а также может изменить способ разработки будущего лечения.

Печень и молекула белка

Новое исследование, опубликованное в журнале Journal of Clinical Investigation , обнаружило процесс, отдельный от изменения передачи сигналов инсулина и чувствительности, который может привести к инсулинорезистентности.Этот процесс, по-видимому, связан с активацией молекулы, называемой белком, связывающим элементы, реагирующие на углеводы (ChREBP), обнаруженной в таких органах, как печень млекопитающих, включая людей и мышей. 6

Исследователи обнаружили, что ChREBP активируется в печени в присутствии высокого уровня фруктозы. А при активации ChREBP стимулирует выработку эндогенной глюкозы. Это, в свою очередь, вызывает повышение количества глюкозы в крови, несмотря на то, что инсулин вырабатывается поджелудочной железой в попытке обуздать уровень глюкозы.

«В течение последних нескольких десятилетий исследователи предполагали, что должна быть проблема в том, как печень воспринимает инсулин, и именно поэтому инсулинорезистентные люди производят слишком много глюкозы», — сказал старший автор исследования Марк Херман. «Мы обнаружили, что независимо от того, сколько инсулина вырабатывает поджелудочная железа, она не может преодолеть процессы, запускаемые этим белком, ChREBP, для стимуляции выработки глюкозы. Это в конечном итоге приведет к повышению уровня сахара в крови и уровня инсулина, что со временем может привести к инсулинорезистентности в других частях тела.”

Исследователи использовали мышей, которые были генетически модифицированы таким образом, чтобы их печень не вырабатывала глюкозу, но при кормлении фруктозой ChREBP активировался, и производство глюкозы стимулировалось независимо от подавляющих усилий инсулина!

Исследователи также проверили эффект на клетках печени человека с аналогичными результатами.

Жировая печень и инсулинорезистентность

Еще один интересный момент, который следует из исследования, может заставить нас переосмыслить связь между ожирением печени и инсулинорезистентностью.

Ранее считалось, что высокое потребление фруктозы, например, в форме подслащенных сахаром напитков, приводит к ожирению печени и, следовательно, к дисфункции печени и инсулинорезистентности. Однако это исследование предполагает, что ожирение печени и повышенное производство глюкозы являются симптомами хронической активации молекулы ChREBP.

В любом случае, если вы продолжите смешивать Sprite и Mountain Dew, кажется, что печень станет жирной, и появится резистентность к инсулину.Так что ограничьте потребление добавленных сахаров — будь то сахароза, глюкоза, фруктоза или другие — до 6 чайных ложек в день!

Фруктоза в свободной форме

Итак, фруктоза естественным образом содержится во фруктах и ​​овощах, не так ли? Означает ли это, что яблоки и морковь нужно оставить у дверей? Черт возьми нет!

Конечно, ChREBP активируется после приема фруктозы — будь то в естественных условиях во фруктах и ​​овощах или в добавленной форме, например, в безалкогольных напитках или обработанных пищевых продуктах.

Однако потребление небольшого количества фруктозы в овощах и фруктах не является чем-то особенным, поскольку эти продукты также содержат клетчатку и множество других фитохимических веществ, которые замедляют усвоение и предлагают организму полезные свойства, такие как антиоксиданты.

С другой стороны, отбрасывание большого количества фруктозы в ее добавленной свободной форме — не такая уж хорошая идея — и именно тогда активация ChREBP становится реальной проблемой.

Интересные штучки!

Это захватывающее время, чтобы наблюдать, как наука продолжает раскрывать сложность человеческого тела, его реакции и взаимодействия с тем, что мы едим и пьем.

Анджела Джонсон (BHSc Nut. Med.)

Артикул:

  1. Международная федерация диабета 2016, Диабет: факты и цифры, просмотрено 6 октября 2016 г.,
  2. Colberg, SR, Sigal, RJ, Fernhall, B, Regensteiner, JG, Blissmer, BJ, Rubin, RR, Chasan-Taber, L, Albright, AL, & Braun, B, 2010, «Упражнения и диабет 2 типа: американец. Колледж спортивной медицины и Американская диабетическая ассоциация: заявление о совместной позиции », Diabetes Care , vol. 33, нет. 12, стр. E147-e167.
  3. Diabetes Australia 2015, Diabetes in Australia, просмотрено 11 июля 2016 г.,
  4. Gropper, SS & Smith, JL 2013, Advanced Nutrition and Human Metabolism , 6 th , Wadsworth, Cengage Learning, Belmont CA
  5. Hechtman, L 2012, Clinical Naturopathic Medicine , Churchill Livingstone, Chatswood, N.S.W
  6. Kim, M Krawczyk, SA Doridot, L Fowler, AJ Wang, JX Trauger, SA Noh, H Kang, HJ Meissen, JK Blatnik, M Kim, JK Lai, M. Herman, MA 2016, «ChREBP регулирует индуцированное фруктозой производство глюкозы. независимо от передачи сигналов инсулина » Journal of Clinical Investigation , vol.126, нет. 11.

Фруктоза вызывает инсулинорезистентность — Гормональное ожирение XXXII | Онлайн-метод прерывистого голодания от доктора Джейсона Фунга для похудения

Метаболизм чрезмерного количества фруктозы приводит к ожирению печени, что является ключевым шагом в развитии инсулинорезистентности, как мы видели в нашем последнем посте. Есть ли доказательства того, что потребление фруктозы приводит к инсулинорезистентности? Одним словом — да.

Еще в 1980 году проводились исследования, связывающие использование фруктозы, но не глюкозы, с развитием инсулинорезистентности у людей.В исследовании «Нарушение клеточного связывания инсулина и чувствительности к инсулину, вызванное кормлением с высоким содержанием фруктозы у здоровых людей» изучали эффект добавления 1000 ккал / день избыточных калорий в виде глюкозы по сравнению с фруктозой у здоровых молодых людей. Масса тела за время теста не изменилась ни в одной из групп.

Пациентам вводили внутривенный инсулин после периода переедания и измеряли уровень глюкозы в крови. Группа с избыточным потреблением глюкозы не показала статистической разницы в чувствительности к инсулину.Однако группа фруктозы показала ухудшение чувствительности к инсулину на 25%. Через 7 дней! Помните, что обе группы перекармливались одинаковым количеством калорий. Фруктоза также вызывала снижение связывания инсулина с клетками, и это происходило параллельно с увеличением инсулинорезистентности.

Более недавнее исследование «Влияние перекармливания фруктозы и приема рыбьего жира на липогенез в печени и чувствительность к инсулину у здоровых мужчин» показало почти такой же эффект. Нормальные здоровые люди перекармливались фруктозой.De novo липогенез (DNL), или производство нового жира в печени, увеличилось в шесть раз, что сопровождается увеличением триглицеридов в плазме на 79%. Показатель инсулинорезистентности в печени увеличился на 28%. Через 6 дней! Инсулинорезистентность мышц не изменилась.

Поскольку инсулинорезистентность является отличительной чертой диабета 2 типа, это означает, что эти ранее здоровые субъекты теперь были на пути к развитию диабета 2 типа всего за 6 дней. Самая пугающая демонстрация того, как чрезмерное потребление фруктозы приводит к инсулинорезистентности и диабету, происходит из исследования «Употребление подслащенных фруктозой, но не подслащенных глюкозой напитков, напитков увеличивает висцеральное ожирение и липиды и снижает чувствительность к инсулину у людей с избыточным весом / ожирением».Здесь здоровым испытуемым давали 25% их дневных калорий в виде Kool-Aid, подслащенного глюкозой или фруктозой, в течение 8 недель. Хотя это кажется высоким процентом, есть много людей, которые потребляют такую ​​высокую долю сахара в своем рационе.

Пероральный тест на толерантность к глюкозе — это стандартный тест при диабете и преддиабете. Уровень сахара в крови измеряется в ответ на выпивку пациенту сладкого напитка. У фруктозы, но не у группы глюкозы уже развился предиабет .Это подтверждается выводом о том, что у группы фруктозы развилась значительно более высокая инсулинорезистентность, чем у группы глюкозы.

Уровень инсулина также значительно выше в группе фруктозы. И все это несмотря на то, что обеим группам давали равное количество глюкозы по сравнению с фруктозой. Кроме того, фруктоза оказывает гораздо меньшее влияние на уровень глюкозы в крови, поскольку имеет очень низкий гликемический индекс. Это демонстрирует еще один провал системы классификации гликемического индекса.

Это так страшно во многих отношениях. Во-первых, количество фруктозы, безусловно, выше, чем потребляет большинство людей. Но исследование длилось всего 8 недель. Что произойдет через десятилетия высокого потребления фруктозы? В частности, фруктоза приводит к ожирению печени, инсулинорезистентности и, в конечном итоге, к диабету 2 типа. Но сопутствующее беспокойство заключается в том, что высокий уровень инсулина также приведет к ожирению .

Если мы добавим эти знания к нашей модели гормонального ожирения, мы получим вот что.

Ключевым фактором ожирения является повышенный уровень инсулина. Это зависит от баланса между диетическими факторами (особенно рафинированными углеводами или углеводами, способствующими ожирению) и защитными факторами, такими как клетчатка и уксус. Другой ключевой фактор, влияющий на уровень инсулина, — это эффект инсулинорезистентности, зависящий от времени. Это создает порочный круг, в котором высокий уровень инсулина увеличивает инсулинорезистентность, что приводит к высокому уровню инсулина. Чем дольше длится этот цикл, тем хуже он становится.

Однако фруктоза также играет ключевую роль в развитии инсулинорезистентности помимо высоких уровней инсулина.Это, по крайней мере, частично объясняется индукцией ожирения печени и печеночной инсулинорезистентности.

Отсюда легко понять, почему сахар так полнеет. Сахароза состоит из 50-50 смеси глюкозы и фруктозы. HFCS на 55% состоит из фруктозы. Глюкоза в смеси действует как очищенный углевод и стимулирует выработку инсулина. Фруктоза действует на печень, вызывая инсулинорезистентность. Следовательно, сахар стимулирует выработку инсулина как в краткосрочной, так и в долгосрочной перспективе.Со временем хроническое чрезмерное потребление сахара приводит к высокому уровню инсулина. Это неизбежно приводит к ожирению.

Сахар — это не просто «пустые калории». Это не просто рафинированные углеводы. Они намного опаснее этого. Они стимулируют как инсулин, так и инсулинорезистентность. Есть ли большая разница между сахарозой и HFCS? Я так не верю. Оба плохие. Один может быть немного хуже, но это секущиеся волосы.

Суть в следующем. Если вы хотите избежать набора веса — исключите из рациона сахар.Не заменяйте их подсластителями. Они одинаково вредны для вас. По крайней мере, с этим могут согласиться все.

Но повышенное потребление сахара не полностью объясняет парадокс азиатского любителя риса 1990-х годов. Как они потребляли столько углеводов, не заболевая ожирением? Следует учесть еще одну вещь. Пшеница.

Продолжить популяцию с переходной экономикой — Гормональное ожирение XXXIII

Начните с калорий I — как мы набираем вес?

Посмотреть всю лекцию — Этиология ожирения 4/6 — Быстрая диета

вопросов и ответов о фруктозе — Food Insight

Что такое фруктоза?

Фруктоза — это моносахарид или отдельный сахар, имеющий ту же химическую формулу, что и глюкоза, но другую молекулярную структуру.Фруктоза, которую иногда называют фруктовым сахаром, содержится во фруктах, некоторых овощах, меде и других растениях. Фруктоза и другие сахара — это углеводы, важный источник энергии для организма.

Какие еще существуют виды сахаров?

Пища содержит различные сахара, называемые моносахаридами (отдельные сахарные единицы, такие как фруктоза и глюкоза) и дисахариды (два моносахарида, связанные вместе). Глюкоза является основным источником энергии для организма, потому что большинство сложных сахаров и углеводов расщепляются на глюкозу во время пищеварения.Крахмал содержит много отдельных сахарных единиц, связанных вместе. Различные сахара выполняют в организме разные функции, но все они могут обеспечивать энергию.

Сахароза — это дисахарид, содержащий равные части глюкозы и фруктозы. Сахароза, известная как столовый или белый сахар, естественным образом содержится в сахарном тростнике и сахарной свекле. К другим сахарам в пищевых продуктах и ​​напитках относятся:

кукурузного крахмала

Лактоза Дисахарид, содержащий глюкозу и галактозу Встречающийся в молоке в естественных условиях
Мальтоза 9033 9033 Кристаллический крахмал 9033 9033 9033 9033 9033 Кристаллический крахмал 9033 9033

Декстроза Другое название глюкозы Кристаллизуется из сахарного тростника, сахарной свеклы и крахмала
Кукурузный сироп В основном отдельные единицы глюкозы Производится из кукурузного крахмала
В первую очередь смесь отдельных единиц глюкозы и фруктозы Производится из кукурузного крахмала

Безопасна ли фруктоза?

Кукурузный сироп с высоким содержанием фруктозы и все другие сахара «в целом признаны безопасными» Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA).

Отчет главного хирурга о питании и здоровье, доклад Национальной академии наук «Диета и здоровье» и «Здоровые люди 2000: национальные цели укрепления здоровья и профилактики заболеваний» Министерства здравоохранения и социальных служб США подтверждают этот вывод.

В научном заявлении 2002 года о сахаре и сердечно-сосудистых заболеваниях Американская кардиологическая ассоциация пришла к выводу, что для большинства людей употребление фруктозы в чистом виде или в форме сахарозы не имеет ни положительных, ни отрицательных эффектов.

Каковы различия в способах метаболизма глюкозы и фруктозы в организме?

Хотя обычно потребляемые сахара содержат примерно одинаковое количество калорий, они метаболизируются и используются организмом по-разному. Например, глюкоза из пищевых источников переваривается, всасывается, транспортируется в печень и выбрасывается в общий кровоток. Многие ткани забирают глюкозу из крови для использования в энергии; для этого процесса требуется инсулин.Фруктоза в основном метаболизируется в печени, но, в отличие от глюкозы, для ее использования организмом не требуется инсулин.

Вызывает ли фруктоза диабет?

Диабет — это заболевание, влияющее на то, как организм вырабатывает и использует инсулин, и как он обрабатывает глюкозу в крови. Инсулин необходим для транспорта глюкозы в клетки. Люди с диабетом I типа не вырабатывают инсулин, тогда как люди с диабетом II типа либо не вырабатывают достаточно инсулина, либо не могут эффективно использовать инсулин, производимый их организмом.Такие факторы, как избыточный вес и ожирение, недостаток физической активности и генетическая предрасположенность, увеличивают риск диабета II типа.
Люди с диабетом должны обращать внимание на количество всех потребляемых углеводов — сахаров и крахмалов.

Поскольку фруктоза не повышает уровень глюкозы в крови и не требует инсулина, люди с диабетом часто переносят ее лучше, чем другие сахара. Фактически, исследования показывают, что небольшое количество фруктозы может улучшить гликемический контроль у людей с диабетом.

Вызывает ли фруктоза ожирение?

Избыточный жир в организме возникает, когда люди не балансируют количество потребляемой энергии (калорий) с выработкой энергии. Дополнительные калории могут поступать из любых калорийных питательных веществ — белков, жиров, алкоголя и углеводов, включая крахмалы и сахара, такие как фруктоза. Недостаток физической активности играет важную роль в накоплении жира в организме и развитии ожирения.

Некоторые исследователи предположили, что фруктоза может не обеспечивать такое насыщение (вызывать чувство сытости), как другие углеводы, потому что она не стимулирует секрецию инсулина и лептина и не подавляет выработку грелина — всех гормонов, которые помогают регулировать голод и прием пищи.Однако важно отметить, что это предположение основано на предварительных исследованиях, в ходе которых уровень фруктозы был по крайней мере в три-четыре раза выше, чем среднее количество, потребляемое американцами. Кроме того, очень немногие американцы когда-либо потребляли фруктозу отдельно, а скорее в сочетании с глюкозой.

Как насчет увеличения употребления HFCS за последние 20 лет и роста показателей ожирения; это причина и следствие?

Нет никаких научных доказательств причинно-следственной связи в отношении потребления HFCS, а не других сахаров, таких как сахароза, в отношении показателей ожирения.Некоторые исследования показывают, что мы потребляем больше калорий, но дисбаланс потребляемых и расходуемых калорий является причиной увеличения веса — мы потребляем больше калорий, чем нам нужно.

Гипотезы, предполагающие рост ожирения, начались в то же время, когда возросшее использование HFCS в продуктах питания и напитках являются корреляциями: взятие двух одновременно происходящих событий и вопрос, могут ли быть причина и следствие. Это может показаться вероятной цепочкой событий, но не обязательно показывает причину и следствие; другие события, которые не были учтены, могут быть столь же важны для рассмотрения.Многие факторы изменились с 1970-х годов, в том числе уровни активности.

Есть ли разница между потреблением калорий и потреблением калорий?

Продолжаются споры о том, есть ли разница между тем, как организм обрабатывает жидкие и твердые калории. Исследования, посвященные этому вопросу, не повторяют друг друга. Некоторые исследования показывают, что уровень сытости при потреблении калорий в жидкой форме такой же, как и при употреблении в твердой форме.Другие исследования показывают, что степень насыщения зависит от источника калорий (напиток или еда). Чтобы ответить на этот вопрос, необходимы дополнительные исследования.

Вызывает ли фруктоза синдром инсулинорезистентности?

Инсулинорезистентность — это состояние, при котором организм не может эффективно использовать вырабатываемый им инсулин. Организм компенсирует это за счет производства большего количества инсулина, чтобы поддерживать нормальный уровень глюкозы в крови. Инсулинорезистентность, наряду с ожирением, гипертонией и нарушениями липидного обмена крови, является частью метаболического синдрома.Инсулинорезистентность иногда приводит к диабету II типа и сердечным заболеваниям.

Хотя экспериментальные животные, получавшие очень большие количества фруктозы, развили инсулинорезистентность, исследования кормления на людях никогда не демонстрировали этот эффект. Считается, что основными факторами развития инсулинорезистентности являются избыток жира, недостаток физической активности и генетическая предрасположенность, а не потребление фруктозы.

Как фруктоза влияет на триглицериды в организме?

Триглицерид — это технический термин, обозначающий жир, который содержится в пище и в организме.Как пищевые жиры, так и углеводы способствуют образованию триглицеридов в организме, но по-разному. Избыточное потребление калорий из жиров, белков или углеводов, в том числе крахмалов и сахаров, способствует накоплению жира в организме.

Исследования на людях показали противоречивые эффекты сахарозы и фруктозы на триглицериды в кровотоке. Различные эффекты могут быть связаны с такими факторами, как количество потребляемой фруктозы; статус массы тела; и исходные уровни триглицеридов, инсулина и глюкозы в крови.Повышение уровня триглицеридов в крови наблюдалось в основном у лиц, ведущих сидячий образ жизни с избыточным весом и ожирения, а также при использовании тестовых диет с высоким содержанием фруктозы и общих углеводов и низким содержанием пищевых волокон и жиров. Некоторые исследования показывают, что хроническое повышение уровня триглицеридов в кровотоке может увеличить риск инсулинорезистентности и ишемической болезни сердца.

Какие продукты и напитки содержат фруктозу?

Природные источники фруктозы включают фрукты, некоторые овощи, мед, сахарный тростник и сахарную свеклу.Поскольку фруктоза входит в состав подсластителей, таких как сахароза и кукурузный сироп с высоким содержанием фруктозы, фруктоза присутствует в различных количествах в широком спектре подслащенных пищевых продуктов и напитков.

Что такое кукурузный сироп с высоким содержанием фруктозы?

Кукурузный сироп с высоким содержанием фруктозы (HFCS) — жидкий подсластитель, используемый в производстве пищевых продуктов и напитков. В конце 1960-х годов ученые разработали ферментативный процесс, который превращает декстрозу (глюкозу) из кукурузного крахмала в смесь фруктозы и глюкозы.Наиболее распространенной формой (70% в пищевых продуктах) является HFCS-55, который содержит 55% фруктозы и 45% глюкозы. Для сравнения, сахароза содержит 50% фруктозы и 50% глюкозы. HFCS-55 и сахароза имеют одинаковую интенсивность сладости.

Какие продукты и напитки содержат кукурузный сироп с высоким содержанием фруктозы?

HFCS присутствует во многих продуктах, включая безалкогольные напитки, морсы, спортивные напитки, выпечку, конфеты, джемы, йогурты, приправы, консервированные и упакованные продукты и другие подслащенные пищевые продукты.

Почему кукурузный сироп с высоким содержанием фруктозы содержится во многих продуктах?

HFCS — полезный ингредиент из-за его сладости и способности смешиваться с другими ингредиентами пищевых продуктов и напитков. Когда методы производства HFCS улучшились, компании, производящие продукты питания и напитки, заменили другие подсластители на HFCS.

Служба экономических исследований Министерства сельского хозяйства США отслеживает количество калорийных подсластителей в продуктах питания, измеряемое на душу населения, с 1966 года. Рафинированный сахар (сахароза) является преимущественно используемым подсластителем, но часть его использования со временем была заменена на HFCS.В 1966 году поставки сахара-рафинада в США на душу населения составляли 97,3 фунта и ноль — для высокофункционального сахара. В 2010 году поставки на душу населения составили 66,0 фунтов для сахара-рафинада и 48,9 фунтов для HFCS. 1 Общий объем поставок всех калорийных подсластителей увеличился на 17% с 1966 по 2010 год. Однако в период с 1999 по 2010 год общие поставки всех калорийных подсластителей снизились на 13%. Поставки подсластителей на душу населения переработчиками и переработчиками США и импорт для прямого потребления производителям продуктов питания, розничным торговцам и другим конечным пользователям представляют собой предложение калорийных подсластителей на душу населения.Фактическое потребление калорийных подсластителей ниже из-за несъеденной пищи, порчи и других потерь.

Сколько фруктозы мне следует употреблять в день?

Нет никаких особых диетических требований или рекомендаций относительно фруктозы. Институт медицины Национальной академии наук (IOM) рекомендует, чтобы общее потребление углеводов составляло от 45 до 65% от калорийности. Большинство углеводов должно поступать из фруктов и фруктовых соков, овощей, цельного зерна, бобовых и молочных продуктов или других богатых источников кальция.

МОМ также обнаружила, что диеты с более чем 25% калорийности добавленных сахаров были связаны со значительным снижением уровней основных питательных веществ (например, кальция, магния и цинка) в некоторых группах населения. Добавленные сахара — это сахара и сиропы, добавляемые в пищу во время обработки или приготовления. IOM не рекомендовал идеальный уровень потребления добавленного сахара.

Рекомендации по питанию для американцев, 2010 год , рекомендуют снизить потребление калорий из добавленных сахаров.Поскольку фруктоза является компонентом большинства добавленных сахаров, уменьшение количества добавленных сахаров в рационе автоматически снижает потребление фруктозы. Добавленные сахара не включают фруктозу, содержащуюся в натуральных фруктах и ​​овощах, которая покрывается уровнями потребления, рекомендованными Диетическими рекомендациями, которые варьируются в зависимости от возраста, пола и уровня физической активности. Для получения дополнительной информации о рекомендуемом потреблении фруктов и овощей щелкните здесь.

Все сахара, включая фруктозу, могут быть включены в здоровую диету, если их употреблять в умеренных количествах.


1 Служба экономических исследований, USDA. Экономика продуктов питания, сельского хозяйства, природных ресурсов и сельских районов Америки. Таблица 50: Количество калорийных подсластителей в США на душу населения для домашнего употребления в пищу и напитки по календарным годам. 25.07.2011.

Пищевая фруктоза активирует передачу сигналов инсулина и воспаление в жировой ткани: модулирующая роль ресвератрола

Влияние диеты с высоким содержанием фруктозы на передачу сигналов инсулина в жировой ткани и воспалительный процесс плохо задокументированы.В этом исследовании мы изучили влияние длительного приема фруктозы и ресвератрола на экспрессию генов, участвующих в передаче сигналов инсулина, а также на уровни воспалительных цитокинов и половых гормонов в белых жировых тканях самцов и самок крыс. Употребление диеты с высоким содержанием фруктозы в течение 24 недель увеличивало экспрессию генов, участвующих в передаче сигналов инсулина, включая IR , IRS-1 , IRS-2 , Akt , PI3K , eNOS , mTOR и PPAR , несмотря на индукцию провоспалительных маркеров, iNOS, TNF, IL-1, IL-18, MDA и ALT, а также противовоспалительных факторов, IL-10 и Nrf2 в жировых тканях мужчин и женщин.Концентрации общего и свободного тестостерона в жировой ткани были снижены у мужчин, но увеличены у женщин, хотя их уровни в крови не изменились. Добавка ресвератрола заметно восстанавливала уровни MDA, IL6, IL-10 и IL-18, а также мРНК iNOS , Nrf2 и PI3K в жировых тканях обоих полов. Пищевая фруктоза активирует как сигнальный путь инсулина, так и воспалительный путь в жировых тканях самцов и самок крыс, что не предполагает корреляции между сигнализацией тканевого инсулина и воспалением.Ресвератрол частично модулирует изменения, вызванные фруктозой.

1. Введение

Региональные запасы жировой ткани варьируются в зависимости от мужского и женского пола. Жировая ткань выполняет функцию эндокринного и метаболического органа, вырабатывающего несколько гормонов и факторов, влияющих на метаболизм жиров и глюкозы, а также чувствительность к инсулину [1]. Нарушение функции жировой ткани и продукции воспалительных цитокинов может усугубить развитие метаболических нарушений [2].Более того, было установлено, что увеличение белой жировой ткани связано с инсулинорезистентностью и воспалением слабой степени [3]. Действие инсулина инициируется активацией его рецептора через субстраты рецептора инсулина (IRS-1 и IRS-2), которые запускают нисходящие сигнальные пути в адипоцитах. При ожирении макрофаги проникают в жировую ткань и начинают индуцировать провоспалительные цитокины, такие как интерлейкин-1 бета (IL-1), фактор некроза опухоли альфа (TNF) и интерлейкин-6 (IL-6), которые могут мешать передаче сигналов инсулина. в адипоцитах [4].Однако мало что известно о влиянии пищевых компонентов, таких как фруктоза, на накопление висцерального жира и его функцию. Было обнаружено, что кормление с высоким содержанием жиров вызывает раннее начало инсулинорезистентности и активацию воспалительного процесса, особенно в сосудистой сети, а затем в скелетных мышцах и печени, но в последнее время в жировой ткани, что указывает на меньшую чувствительность жировой ткани к пагубному воздействию факторов питания [5] . Кроме того, сообщалось, что диета с высоким содержанием фруктозы у крыс активирует воспалительные факторы, такие как ядерный фактор каппа B () и TNF, в печени, но не в жировой ткани, что демонстрирует его тканеспецифические эффекты [6].В этом смысле мы показали, что диетический кукурузный сироп с высоким содержанием фруктозы (HFCS) в течение 12 недель вызывал раннее повреждение сосудов и инсулинорезистентность, но было субвоспалительное состояние в печени, несмотря на усиление липогенеза в печени [7, 8]. Механизм инсулинорезистентности и ее связь с воспалительным процессом в различных тканях, особенно в жировой ткани, изучены недостаточно [9].

Растущая глобальная эпидемия метаболического синдрома может быть связана с чрезмерным потреблением фруктозы в нынешнем рационе человека, особенно в виде подслащенных напитков.Некоторые данные подтверждают, что эстроген защищает женщин от признаков метаболических нарушений, вызванных диетой [10–12]. Однако дифференцированная восприимчивость к заболеванию в зависимости от состава рациона самцов и самок изучена недостаточно, и экспериментальные исследования метаболического синдрома обычно проводят на самцах животных. Доказано, что диета с высоким содержанием фруктозы провоцирует метаболические нарушения у самцов крыс; однако, еще предстоит установить, существуют ли различия в реактивности жировой ткани на диетическую фруктозу между мужчинами и женщинами.Недавно мы предположили, что индуцированная фруктозой метаболическая дисфункция может быть связана с накоплением жира в брюшной полости, но независимо от общего ожирения, у женщин, в отличие от мужчин [13]. Кроме того, в вышеупомянутом исследовании мы также показали, что ресвератрол, многофункциональное соединение, которое содержится в винограде и вине, приводит к значительному снижению веса сальника в связи с улучшением гиперинсулинемии и гипертриглицеридемии у самцов и самок крыс после кормления фруктозой. .Исследование влияния диеты с высоким содержанием фруктозы на сигнализацию инсулина в жировой ткани и воспалительный процесс и их модификация ресвератролом предоставит новые идеи для понимания механизмов. Поэтому в данном документе мы исследовали влияние пищевых добавок фруктозы и ресвератрола на экспрессию генов сигнальных элементов инсулина и воспалительных цитокинов в жировой ткани самцов и самок крыс. Таким образом, в этом исследовании с долгосрочной диетой с высоким содержанием фруктозы (в течение 24 недель, 10% -ный напиток) мы стремились моделировать потребление текущей высокоуглеводной диеты у людей.

2. Материалы и методы
2.1. Химические вещества

Химические вещества были приобретены у Sigma Chemical Co. (Сент-Луис, Миссури), если не указано иное. Фруктоза была получена от Danisco Sweeteners OY (Финляндия), а транс -ресвератрол был от Herb-Tech (ROC). Чистоту ресвератрола проверяли с помощью ВЭЖХ с последующей ЖХ-МС, и 98% компонента было определено как транс -ресвератрол.

2.2. Животные и диеты

Протоколы для животных были одобрены Комитетом по этическим исследованиям на животных Университета Гази (GU ET-10.045). Четырехнедельных самцов и самок крыс линии Вистар содержали в комнатах с контролируемой температурой и влажностью (20–22 ° C) с 12-часовым циклом свет-темнота. Животных кормили стандартной диетой для грызунов, которая состояла из 62% крахмала, 23% белка, 4% жира, 7% целлюлозы, стандартных витаминов и смеси солей. После акклиматизации в течение 1 недели самцы и самки крыс были случайным образом разделены на четыре группы в качестве контроля: ресвератрол, фруктоза и ресвератрол плюс фруктоза (ресвератрол + фруктоза). Крысам давали фруктозу в виде 10% раствора в питьевой воде ad libitum в течение 24 недель.Ресвератрол добавляли к корму в дозе 500 мг / кг, которую хранили в защищенном от света месте. Все крысы получали стандартную диету с ресвератролом ad libitum или без него в течение 24 недель. Вес тела, потребление пищи и жидкости регистрировали еженедельно в течение периода наблюдения. Ежедневное потребление ресвератрола рассчитывалось на основе количества потребляемой пищи. Ежедневное потребление фруктозы определялось путем измерения потребления жидкости. Самок крыс выбирали случайным образом в разные дни эстрального цикла во время умерщвления.В конце периода наблюдения крыс анестезировали смесью кетамин-ксилазин (100 и 10 мг / кг, соответственно, внутрибрюшинно), после чего быстро брали пробы крови посредством сердечной пункции. Жировые ткани сальника рассекали, промокали насухо, взвешивали, замораживали в жидком азоте и хранили при -85 ° C.

2.3. Измерение метаболических параметров в плазме и жировой ткани

Образцы сердечной крови не голодных самцов и самок крыс немедленно центрифугировали при 4 ° C и 10000 g в течение 30 мин.Образцы жировой ткани гомогенизировали 0,1 М фосфатным буфером 1:10 (мас. / Об.), PH 7,4 и 24000 циклов / мин (Ultra Turrax, США), а затем обрабатывали ультразвуком при 20000 циклов / сек в течение 1 мин (д-р Хильшер, Германия. ). Гомогенаты центрифугировали при 4 ° C и 10000 g в течение 15 мин и собирали супернатанты. Все образцы хранили при -85 ° C до анализа. Уровни триглицеридов в плазме, активность аланинаминотрансферазы (ALT) и аспартаттрансаминазы (AST) определяли с использованием стандартных ферментативных методов (Biolabo, Франция).Уровни инсулина (Mercodia, Швеция), эстрадиола, свободного и общего тестостерона, TNF, IL-1, IL-6 и интерлейкина-10 (IL-10) (eBioscience, США), уровни интерлейкина-18 (IL-18) (Cusabio, Китай) были измерены с использованием коммерческих наборов для ELISA в соответствии с инструкциями производителя. Уровни малонового диальдегида (MDA) измеряли с помощью набора для анализа веществ, реагирующих с тиобарбитуровой кислотой (TBARS) (Cayman Chemical, США).

2.4. Определение экспрессии генов с помощью полимеразной цепной реакции в реальном времени

Суммарные РНК выделяли из тканей брюшной полости с использованием набора для выделения тотальной РНК RNeasy (Qiagen, Венло, Нидерланды), как описано в соответствии с протоколом производителя.После выделения количество и качество общих РНК определяли спектрофотометрией и электрофорезом в агарозном геле. Затем 1 мкл г тотальной РНК подвергали обратной транскрипции в кДНК с использованием коммерческого набора для синтеза первой цепи кДНК (Thermo Scientific, США). Уровни экспрессии бета-рецептора инсулина ( IR ), IRS-1 , IRS-2 , протеинкиназы B ( Akt ), фосфоинозитид-3-киназы ( PI3K ), эндотелиальной синтазы оксида азота ( eNOS ), сиртуин 1 ( SIRT1 ), мишень рапамицина у млекопитающих ( mTOR ), гамма-рецептор, активируемый пролифератором пероксисом ( PPAR ), фактор 2, связанный с ядерным эритроидом 2 ( Nrf2 ), ядерный фактор каппа B () и гены индуцибельной синтазы оксида азота ( iNOS ) определяли с помощью полимеразной цепной реакции в реальном времени (qRT-PCR, LightCycler480 II, Roche, Basel, Switzerland).Для этого 1 мкл кДНК л, 5 мкл л 2X SYBR Green Master Mix (Roche FastStart Universal SYBR Green Master Mix) и пары праймеров (Таблица 1) при концентрациях 0,5 мкМ M в конечном объеме Смешивали 10 мкл л и проводили qRT-PCR следующим образом: начальная денатурация при 95 ° C в течение 10 минут, денатурация при 95 ° C в течение 10 секунд, отжиг при 58 ° C в течение 15 секунд и удлинение при 72 ° C. в течение 15 секунд с 45 повторяющимися тепловыми циклами, измеряя зеленую флуоресценцию в конце каждого шага удлинения.Все реакции были выполнены в трех экземплярах, и специфичность продуктов ПЦР была подтверждена с помощью анализа расплава. Относительную экспрессию генов по отношению к внутреннему контролю глицеральдегид-3-фосфатдегидрогеназы ( GAPDH ) рассчитывали с помощью инструмента предварительной относительной количественной оценки с поправкой на эффективность, предоставленного программным обеспечением LightCycler® 480 SW 1.5.1.

NM_012969.1

NM_001168633.1

Енос

XM_006235872.1

SIRT1

XM_008772947.1

Nrf2

XM_006234397.2

AF_079314.1

иОАС

XM_006246949.2

GAPDH


Ген Последовательность прямого праймера ( Последовательность обратного праймера () Длина продукта
(п. IR
GTGCTGCTCATGTCCTTAGA AATGGTCTGTGCTCTTCGTG 234 XM_006248753.2
IRS-1 GCCAATCTTCATCCAGTTGC CATCGTGAAGAAGGCATAGG 337
IRS-2 CTACCCACTGAGCCCAAGAG CCAGGGATGAAGCAGGACTA 151
Akt GAAGAAGAGCTCGCCTCCAT GAAGGAGAAGGCCACAGGTC 211 NM_033230.2
PI3K
PI3KACCAT_ 2
TGCACCCTTCCGGGGATTCT GGATCCCTGGAAAAGGCGGT 189
CGGTCTGTCAGCATCATCTTCC CGCCTTATCCTCTAGTTCCTGTG 136
MTOR GCAATGGGCACGAGTTTGTT AGTGTGTTCACCAGGCCAAA 94 NM_019906.1
PPARγ CTCAGGTC3 CTCAGGTC790AGTC3.1
GATTCGTGCACAGCAGCA GCCAGCTGAACTCCTTAGAC 466
NF B GGGTCAGAGGCCAATAGAGA CCTAGCTTTCTCTGAACTGCAAA 71
CTTCAGGTATGCGGTATTGG CATGGTGAACACGTTCTTGG 352
TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTGGGCCAT 240 NM_017008.4

2.5. Статистический анализ

Все данные представлены как среднее ± стандартная ошибка среднего; количество крыс. Статистические сравнения проводили с использованием непарного критерия Стьюдента или однофакторного дисперсионного анализа с последующим апостериорным тестом Бонферрони. значения меньше 0,05 считались статистически значимыми.

3. Результаты
3.1. Влияние диетической фруктозы и ресвератрола на метаболические и эндокринные параметры в плазме и жировых тканях

Данные, представляющие массу тела, массу сальникового жира, ежедневную пищу, потребление жидкости и калорий, а также потребление ресвератрола и фруктозы крысами. были опубликованы в нашем недавнем исследовании [13]; однако они снова были включены в Таблицу 2, чтобы облегчить понимание текущего исследования.Пищевая фруктоза вызвала значительный прирост массы тела у самцов крыс (по сравнению с соответствующим контролем), который снижается при добавлении ресвератрола (по сравнению с соответствующей фруктозой), но не у самок крыс (таблица 2). Важно отметить, что лечение фруктозой увеличивало массу сальникового жира как у самцов, так и у самок крыс (по сравнению с их соответствующими контрольными группами), которые отреагировали на добавление ресвератрола значительным снижением (по сравнению с соответствующими группами фруктозы, таблица 2). Диета с высоким содержанием фруктозы увеличивает уровни триглицеридов и инсулина в плазме (по сравнению с соответствующими контрольными группами), которые значительно снижаются ресвератролом (по сравнению с соответствующими группами фруктозы) у обоих полов (таблица 2), как продемонстрировано в нашем недавнем исследовании [13].Ресвератрол снижает уровень инсулина в жировой ткани здоровых самок крыс (по сравнению с соответствующим контролем). Диетическая фруктоза увеличивала уровень инсулина в жировой ткани как самцов, так и самок крыс (по сравнению с соответствующими контрольными группами), которые реагировали на добавление ресвератрола значительным снижением (по сравнению с соответствующими группами фруктозы, таблица 3).

9033 903 10.7

9033

94

90ruct

Вес сальника / масса тела 903 (%)

3

903 903 Женский

9033 9033

03 .09

903 903 9034 3 ± 0,1 9034


⁢Группы Контроль Res Fruc Res + Fruc

335 ± 4,1 415 ± 6,5 371 ± 5,1
Женский 249 ± 6,7 227 ± 7,5 260 ± 1,8 235 ± 1,5
Прием пищи (г / сут) Мужчины 20,74 ± 0,83 24,6 ± 1,1 20,5 ± 1,1 21,9 ± 1,1
Женщины 14,4 ± 0,8 18,3 ± 0,6 12 12.8 ± 0,4

Потребление жидкости (мл / день) Мужчина 46,5 ± 2,1 61,2 ± 2,4 56,8 ± 1,6 55,9 ± 1,6
± 0,9 38,9 ± 1,3 38,1 ± 1,3 37,8 ± 1,3

Общая калорийность (ккал) Мужчины 72,6 ± 2,9 86,1 ± 3,39 ± 4,2 99,5 ± 4,5
Женщина 50,5 ± 2,9 64,1 ± 2,2 60,1 ± 2,2 60,3 ± 2,1

мг Ресверат Мужской 36 ± 1,2 29 ± 0,8
Женский 40 ± 2,1 27 ± 0,5
потребление (г / день) Мужчины 5.7 ± 0,2 5,6 ± 0,2
Самка 3,8 ± 0,1 3,8 ± 0,1

0,53 ± 0,02 0,57 ± 0,03 1,39 ± 0,32 0,95 ± 0,10
Женский 0,88 ± 0,04 0,59 ± 0,03 1,64 ± 0,23 9033 9033 9033 9033 9033 9033 9033 9033 9033
Глюкоза (мг / дл) Мужской 129.5 ± 10,9 95,3 ± 6,1 129,4 ± 19,1 113,8 ± 8,6
Женский 103,7 ± 3,7 87,6 ± 4,2 113,2 ± 7,8 100,9 ± 2,3

2

2

Инсулин (нг / мл) Мужской 0,48 ± 0,13 0,40 ± 0,09 4,38 ± 0,52 1,28 ± 0,27
Женский 0,33 ± 0,08

0,2997 ± 0,34 2,08 ± 0,66

Триглицерид (мг / дл) Мужской 88,9 ± 9,4 49,2 ± 4,6

132,8 ± 8,53

81,6 ± 8,4 64 ± 8,3 205,1 ± 27,2 102,9 ± 14,1 # †

Эстрадиол (пг / мл) 1,7337 ± 27,23 9,3 ± 1,1 13 ± 2,3 9,9 ± 1,2
Женский 41,6 ± 13 49,2 ± 10,6 33,8 ± 8,7 43,1 ± 6,9
Свободный тестостерон (пг / мл) Мужской 25,7 ± 0,6 23,1 ± 0,9 23,1 ± 1,9 29,3 ± 1
Женский 2,5 ± 0,17 3,1 ± 0,09

2,9 ± 0,17 3,1 ± 0,09 2,7 ± 0,02

Общий тестостерон (нг / мл) Мужчины 3 ± 0,01 3,1 ± 0,12 2,7 ± 0,12 0,29 ± 0,01 0,29 ± 0,01 0,3 ± 0,01 0,27 ± 0,02

Значения выражены как среднее ± SEM, –12.
Значительно отличается () от контрольной группы.
Значительно отличается () от группы фруктозы.
Значительно отличается () от мужской группы.

9034

903 ± 0,6

Общий тестостерон (пг / г белка)

192 ± 22

Женский

ИЛ-10 (нг / г белка)


⁢Группы Контроль Res Fruc Res + Fruc
1,54 ± 0,16 1,19 ± 0,17 2,75 ± 0,42 1.32 ± 0,27
Самка 1,45 ± 0,16 0,79 ± 0,1 2,93 ± 0,26 1,63 ± 0,26

Эстрадиол 3 8,6 ± 1,1 13 ± 1,5 9 ± 1,1
Женский 27,5 ± 8 28 ± 5,1 14 ± 1,8 22 ± 4,6
904290

Свободный тестостерон (пг / г белка) Мужской 45 ± 4.9 48 ± 7,8 21 ± 2,8 26 ± 4
Женский 2,8 ± 0,8 1,5 ± 0,1 5,6 ± 0,1 2 ± 0,4


Мужской 655 ± 51 581 ± 78 285 ± 33 332 ± 43
Женский 32 ± 6,1 16 ± 3 9,5 25.7 ± 4,9

MDA ( µ моль / г белка) Самец 16 ± 1,9 18 ± 4,9 26 ± 3,6 14 ± 1,9 Женщина

14 ± 2,1 5,3 ± 0,8 48 ± 13 12 ± 2,1

АЛТ (ед. / Г белка) Мужской 169 ± 14 335 ± 73 448 ± 135
Женский 272 ± 47 113 ± 13 736 ± 145 315 ± 39

AST (белок U / 847) Мужской 85 ± 5 119 ± 27 123 ± 28 271 ± 55
Женский 164 ± 18 51 ± 11 346 ± 56 142.1 ± 5

TNF- α (нг / г белка) Мужской 153 ± 10 163 ± 7 261 ± 31 218 ± 33

111 ± 9 99 ± 6 319 ± 41 184 ± 38

IL-1 β (нг / г белка) Мужчина 382 250 ± 17 496 ± 38 548 ± 44
Женский 241 ± 26 270 ± 17 703 ± 108 445 ± 68
9034


-6 (нг / г белка)

Самец 61 ± 4.6 46 ± 2,5 67 ± 6,4 36 ± 5,3
Женский 13 ± 1,3 11 ± 1,9 51 ± 7,4 20 ± 3,1
9047 Мужской 50 ± 7,6 52 ± 4,7 83 ± 13,3 40 ± 5,8
Женский 52 ± 6,2 33 ± 4,1 93 ± 7,6 55 ± 6,1

IL-18 (MBL) ( µ г / г белка) Мужской 9.4 ± 1,6 7,6 ± 0,7 39 ± 7,7 19 ± 3,8
Женский 7,5 ± 1,4 8,3 ± 0,6 37 ± 6,2 14 ± 2,5

Значения выражены как среднее ± SEM, –12.
Значительно отличается () от контрольной группы.
Значительно отличается () от группы фруктозы.
Значительно отличается () от мужской группы.

Ресвератрол снижал уровень свободного тестостерона в жировой ткани, но повышался в плазме здоровых самок крыс (по сравнению с соответствующим контролем). Пищевая фруктоза не влияла на уровень тестостерона в плазме крови у обоих полов; однако это диетическое вмешательство ухудшило концентрации общего и свободного тестостерона в жировой ткани у мужчин (по сравнению с соответствующим контролем) и, наоборот, увеличило концентрации у женщин (по сравнению с соответствующим контролем). Более того, кормление фруктозой снижало уровень эстрогена в жировой ткани у женщин (по сравнению с соответствующим контролем), но не изменялся у мужчин.Добавка ресвератрола снижала уровни свободного и общего тестостерона в жировой ткани женщин при кормлении фруктозой (по сравнению с соответствующей фруктозой, таблицы 2 и 3).

3.2. Влияние диетической фруктозы и ресвератрола на цитокины и маркеры окислительного стресса в жировых тканях

Результаты показывают, что у самок контрольных крыс уровни ИЛ-1, ИЛ-6 и ФНО значительно ниже, чем у самцов, но было наоборот. условие активности АСТ (). Ресвератрол снижал уровни MDA, ALT и AST в жировой ткани здоровых самок крыс, но только IL-1 у самцов (по сравнению с соответствующими контрольными группами, таблица 3).Диета с высоким содержанием фруктозы вызвала заметное повышение уровней МДА, АЛТ и АСТ в жировой ткани самцов и самок крыс (по сравнению с их соответствующими контролями). Воспалительные цитокины, TNF, IL-1, IL-6, IL-10 и IL-18 также были повышены в жировых тканях самцов и самок крыс при диетическом вмешательстве фруктозы (по сравнению с их соответствующими контролями). Добавка ресвератрола значительно снижала уровни MDA, IL-6, IL-10 и IL-18 в жировой ткани самцов и самок крыс при кормлении фруктозой (по сравнению с их соответствующими группами фруктозы).Более того, эта добавка также снизила уровни ALT, AST и TNF у женщин (по сравнению с соответствующей группой фруктозы, Таблица 3).

3.3. Влияние диетической фруктозы и ресвератрола на IR, IRS-1, IRS-2, Akt, PI3K, eNOS, SIRT1, mTOR, PPAR, Nrf2 и экспрессию генов iNOS в жировых тканях

Уровни экспрессии генов IR , IRS-1 , IRS-2 , Akt , PI3K , eNOS , SIRT1 , mTOR , PPAR , Nrf2 и iNOS в жировой ткани. образцы тканей самцов и самок крыс были получены с помощью ПЦР-анализа в реальном времени.Содержание фруктозы в рационе увеличилось. образцы жировой ткани от самцов и самок крыс (по сравнению с их соответствующими контрольными группами), тогда как никаких изменений не наблюдалось в экспрессии мРНК SIRT1 и у обоих полов (Рисунки 1 (a) –1 (l)). Наблюдалось притупленное увеличение уровней мРНК iNOS и PPAR в жировой ткани самок крыс в ответ на диетическую фруктозу (по сравнению с соответствующими самцами).Однако в целом принадлежность к женщине не обеспечивает никакой защиты от вредного воздействия фруктозы.

Добавка ресвератрола значительно снижала экспрессию мРНК PI3K и iNOS у самцов и самок крыс при кормлении фруктозой. Однако это добавление уменьшало мРНК Akt , PPAR и eNOS только у женщин и мРНК Nrf2 у мужчин (по сравнению с их соответствующими группами фруктозы, Рисунки 1 (a) –1 (l)).

4. Обсуждение

Характерной чертой метаболического синдрома является увеличение висцеральной жировой ткани. В недавнем исследовании мы показали, что фруктоза с пищей вызывает повышение уровня инсулина и триглицеридов в плазме в сочетании с увеличением массы сальника, что указывает на метаболический синдром и увеличение висцерального ожирения у самцов и самок крыс [13]. Влияние диеты с высоким содержанием фруктозы на передачу сигналов инсулина в жировой ткани и ее связь с воспалительным процессом недостаточно изучены.Расширяя наше исследование, мы сосредоточились на влиянии длительного потребления фруктозы на экспрессию генов, участвующих в передаче сигналов инсулина и воспалительных цитокинов в жировой ткани крыс обоих полов. Наши результаты показали, что накопление висцерального жира, вызванное пищей, вызванное фруктозой, привело к увеличению экспрессии генов, отвечающих за передачу сигналов инсулина, изменило эндокринную функцию и активировало провоспалительные и противовоспалительные маркеры в жировой ткани самцов и самок крыс. Гендерные различия в кормлении фруктозой не были заметными, что свидетельствует о том, что принадлежность к женщине не дает никаких преимуществ в защите от вредного воздействия фруктозы.Добавка ресвератрола восстанавливала повышенные уровни MDA, IL-10 и IL-18, а также экспрессию мРНК iNOS и PI3K в жировой ткани у обоих полов; однако его эффективность в отношении сигнального пути инсулина и других измеряемых параметров была ограничена или, скорее, зависела от пола.

Наши недавние открытия показали, что нарушение обмена веществ, вызванное употреблением фруктозы, более вероятно связано с накоплением жира в брюшной полости, но не зависит от общего ожирения.Длительное употребление фруктозы в рационе увеличивало массу тела у мужчин, в то время как у женщин не меняло [13]. Масса висцеральной жировой ткани увеличивалась у субъектов, потребляющих напитки с фруктозой, а не у тех, кто употреблял напитки с глюкозой, что позволяет предположить, что фруктоза с пищей более тесно связана с метаболическими заболеваниями и ожирением [14]. Передача сигналов инсулина в адипоцитах инициируется активацией его рецептора через IRS-1 и IRS-2, передающие сигнал внутриклеточным эффекторам.Передача сигналов инсулина также удлиняет различные связи с путями eNOS, SIRT1, PPAR и mTOR [9, 15-17]. Инсулин может активировать липогенные гены и стимулировать липогенез в адипоцитах, распознаваемый как синтез жирных кислот de novo , но механизмы менее известны, чем механизмы печени [9]. В печени диета с высоким содержанием фруктозы вызывает гиперинсулинемию и усиление липогенеза, что, в свою очередь, увеличивает эктопическое отложение липидов, несмотря на инсулинорезистентность печени и неадекватный контроль гипергликемии [8, 18, 19].Было показано, что диета с высоким содержанием жиров и фруктозы стимулирует липогенез за счет увеличения экспрессии гена FAS в жировой ткани мышей [20–22]. С другой стороны, сообщалось, что экспрессия липогенного фактора транскрипции SREBP1 и липогенез снижены в жировой ткани мышей с ожирением, хотя экспрессия воспалительных генов в адипоцитах и ​​липогенная способность печени увеличиваются [23, 24]. Эти результаты показали, что липогенный ответ жировой ткани при метаболическом синдроме и ожирении еще не полностью изучен.

Ранее было показано, что нарушение IRS-2 у мышей вызывает выраженную резистентность к инсулину в жировой ткани [25]. Было обнаружено, что фосфорилирование IRS-1 и IRS-2 повышается в лизатах жировой ткани мышей с гиперинсулинемией [20]. Здесь мы обнаружили повышение уровня инсулина в жировой ткани и активацию мРНК IR , IRS-1 и IRS-2 , а также нижестоящих эффекторов инсулина Akt , PI3K , eNOS , МРНК mTOR и PPAR , но без изменений в экспрессии мРНК SIRT1 в связи с увеличением сальниковой массы самцов и самок крыс.Это может отличаться от ситуации, наблюдаемой в других чувствительных к инсулину органах, таких как печень, мышцы и сосудистая система, где подавление передачи сигналов инсулина было определено как следствие потребления фруктозы у грызунов [7, 8, 13, 26, 27 ]. Поэтому есть соблазн предположить, что активация сигнального пути инсулина в жировой ткани приводит к увеличению висцерального ожирения. В исследованиях по изучению диетической фруктозы на жировой ткани было обнаружено, что кратковременное употребление раствора фруктозы (10% фруктозы в течение 3 недель) снижает экспрессию генов IRS-1 и IRS-2 в увеличенной жировой ткани брюшной полости крыс [28, 29] .Потребление кукурузного сиропа с высоким содержанием фруктозы (в течение 10 месяцев) вызывало подавление гена IRS-1 в сочетании с повышенной экспрессией TNF, IL-1 и IL-6 во внутрибрюшной жировой ткани, но не в тканях печени и скелета. мышца у мышей [30]. Эти тканеспецифичные и противоречивые результаты требуют дополнительных исследований, чтобы понять точное влияние фруктозы, содержащейся в рационе, на эффекторы инсулина в жировой ткани и других чувствительных органах.

При ожирении макрофаги проникают в жировую ткань и начинают индуцировать провоспалительные цитокины, такие как ИЛ-1, ФНО и ИЛ-6, которые способствуют развитию инсулинорезистентности [4].Было показано, что длительная обработка адипоцитов IL-6, IL-1 или TNF ингибирует передачу сигналов инсулина и вызывает инсулинорезистентность [31, 32]. Сообщалось, что диета с высоким содержанием фруктозы у крыс активирует воспалительные факторы, включая NF-B и TNF, в печени, в отличие от жировой ткани, что указывает на тканеспецифические эффекты пищевой фруктозы [6]. При этом фруктоза с пищей увеличивала уровни провоспалительных маркеров, iNOS, TNF, IL-1, IL-18, MDA и ALT, а также противовоспалительных факторов, IL-10, Nrf2 и mTOR, в жировой ткани мужчин. и самки.Эти последние факторы могут быть активированы в качестве компенсаторного механизма противодействия воспалению, как сообщалось ранее в жировой ткани [16, 33, 34]. В этом звуке было обнаружено, что уровень мРНК PPAR, который является сенсибилизирующей к инсулину молекулой, повышен в висцеральной жировой ткани у инсулинорезистентных пациентов, несмотря на наличие воспалительного состояния, что предполагает компенсаторный механизм [35], в соответствии с с нашими результатами с повышенной экспрессией мРНК PPAR из-за фруктозной диеты.Недавнее исследование показало, что диета, обогащенная фруктозой (в течение 8 недель), активирует провоспалительный цитокин IL-6, сопровождаемый снижением PPAR, не вызывая гиперинсулинемии, в жировой ткани крыс [36]. В родственном исследовании было показано, что диета с высоким содержанием фруктозы снижает уровень IL-10, но не меняет уровни TNF; однако дефицит PPAR сделал очевидной инсулинорезистентность в сочетании с повышенными воспалительными маркерами в жировой ткани мышей [37]. Расхождение между вышеупомянутыми и настоящими исследованиями можно объяснить различиями в методе и продолжительности кормления, чтобы вызвать нарушение обмена веществ.Что касается гендерных различий в фруктозной диете, все наши вышеупомянутые результаты показали, что принадлежность к женщине не дает никаких преимуществ в защите от вредных последствий этого пищевого вмешательства.

Наши данные с половыми гормонами показали, что диетическая фруктоза изменяет эндокринную функцию жировой ткани крыс, при этом уровни общего и свободного тестостерона снижены у мужчин, но повышены у женщин. Напротив, у самок уровень эстрогенов снижался, но у самцов не изменялся.Не было изменений в уровнях тестостерона и эстрогена в крови, что частично согласуется с предыдущими результатами у крыс, получавших много фруктозы [38, 39]. Значимость взаимного неблагоприятного воздействия фруктозы с пищей на уровни тестостерона у мужчин и женщин, а также ее уменьшающееся влияние на эстроген у женщин в жировой ткани еще предстоит понять, что может быть неотложной проблемой. С другой стороны, восстанавливающий эффект ресвератрола на уровень тестостерона в жировой ткани женщин может представлять потенциальный интерес.

Добавка

ресвератрола не изменила увеличенную экспрессию мРНК IR , IRS-1 и IRS-2 в жировой ткани самцов и самок крыс, получавших высокое содержание фруктозы. Однако мы обнаружили снижение экспрессии мРНК PI3K у обоих полов, а также экспрессии мРНК Akt , eNOS и PPAR у женщин после приема ресвератрола. Ранее сообщалось, что лечение ресвератролом восстанавливает стимулированное инсулином фосфорилирование Akt () в печени и жировой ткани, но не в скелетных мышцах мышей, получавших питание с высоким содержанием жира [40].Было показано, что у обезьян-резусов с высоким содержанием жиров и сахара, добавление ресвератрола увеличивает уровень белка IRS-1, но снижает фосфорилирование Akt () в висцеральной жировой ткани [41]. В этом исследовании ресвератрол также увеличивает экспрессию SIRT1 во висцеральной, но не подкожной жировой ткани. Здесь уровень мРНК SIRT1 не изменился при лечении ресвератролом у обоих полов. В наших недавних исследованиях добавление ресвератрола увеличивало уровни мРНК и белка IRS-1 , а также уровни мРНК IRS-2 в печени, но не в ткани сосудов крыс, получавших HFCS [7, 8].Однако в сравнительном исследовании между полами мы определили некоторые различия в активации сосудов IRS-1 у мужчин и IRS-2 у женщин при кормлении фруктозой путем лечения ресвератролом [13]. Таким образом, можно предположить, что разнообразие эффектов ресвератрола на сигнальный путь инсулина может зависеть от типов тканей, животных и рациона, а также от пола.

Снижение уровней MDA, IL-6, IL-10 и IL-18, а также мРНК Nrf2 и iNOS наблюдалось после добавления ресвератрола самцам и самкам крыс, питавшимся фруктозой.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *